ID: 972352457

View in Genome Browser
Species Human (GRCh38)
Location 4:38248670-38248692
Sequence TCCCAAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1020377
Summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972352457_972352464 23 Left 972352457 4:38248670-38248692 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031
972352457_972352463 5 Left 972352457 4:38248670-38248692 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 972352463 4:38248698-38248720 AGGCGCGCTGATCATGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972352457 Original CRISPR TCCCAAAGTGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr