ID: 972352457

View in Genome Browser
Species Human (GRCh38)
Location 4:38248670-38248692
Sequence TCCCAAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972352457_972352463 5 Left 972352457 4:38248670-38248692 CCTGTAATCCCAGCACTTTGGGA No data
Right 972352463 4:38248698-38248720 AGGCGCGCTGATCATGAGTCAGG No data
972352457_972352464 23 Left 972352457 4:38248670-38248692 CCTGTAATCCCAGCACTTTGGGA No data
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972352457 Original CRISPR TCCCAAAGTGCTGGGATTAC AGG (reversed) Intergenic