ID: 972352459

View in Genome Browser
Species Human (GRCh38)
Location 4:38248678-38248700
Sequence CCTTGGCCTCCCAAAGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 770729
Summary {0: 84285, 1: 209100, 2: 236161, 3: 152470, 4: 88713}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972352459_972352465 24 Left 972352459 4:38248678-38248700 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 972352465 4:38248725-38248747 CGAGACCATCCTGGCTAATATGG 0: 922
1: 39336
2: 59262
3: 100394
4: 181947
972352459_972352464 15 Left 972352459 4:38248678-38248700 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031
972352459_972352463 -3 Left 972352459 4:38248678-38248700 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 972352463 4:38248698-38248720 AGGCGCGCTGATCATGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972352459 Original CRISPR CCTTGGCCTCCCAAAGTGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr