ID: 972352461

View in Genome Browser
Species Human (GRCh38)
Location 4:38248679-38248701
Sequence GCCTTGGCCTCCCAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 721059
Summary {0: 52775, 1: 164492, 2: 216668, 3: 175886, 4: 111238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972352461_972352464 14 Left 972352461 4:38248679-38248701 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031
972352461_972352463 -4 Left 972352461 4:38248679-38248701 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 972352463 4:38248698-38248720 AGGCGCGCTGATCATGAGTCAGG No data
972352461_972352465 23 Left 972352461 4:38248679-38248701 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 972352465 4:38248725-38248747 CGAGACCATCCTGGCTAATATGG 0: 922
1: 39336
2: 59262
3: 100394
4: 181947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972352461 Original CRISPR GCCTTGGCCTCCCAAAGTGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr