ID: 972352462

View in Genome Browser
Species Human (GRCh38)
Location 4:38248695-38248717
Sequence GACTCATGATCAGCGCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972352462_972352465 7 Left 972352462 4:38248695-38248717 CCAAGGCGCGCTGATCATGAGTC No data
Right 972352465 4:38248725-38248747 CGAGACCATCCTGGCTAATATGG 0: 922
1: 39336
2: 59262
3: 100394
4: 181947
972352462_972352464 -2 Left 972352462 4:38248695-38248717 CCAAGGCGCGCTGATCATGAGTC No data
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972352462 Original CRISPR GACTCATGATCAGCGCGCCT TGG (reversed) Intergenic
No off target data available for this crispr