ID: 972352462 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:38248695-38248717 |
| Sequence | GACTCATGATCAGCGCGCCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972352462_972352465 | 7 | Left | 972352462 | 4:38248695-38248717 | CCAAGGCGCGCTGATCATGAGTC | No data | ||
| Right | 972352465 | 4:38248725-38248747 | CGAGACCATCCTGGCTAATATGG | 0: 922 1: 39336 2: 59262 3: 100394 4: 181947 |
||||
| 972352462_972352464 | -2 | Left | 972352462 | 4:38248695-38248717 | CCAAGGCGCGCTGATCATGAGTC | No data | ||
| Right | 972352464 | 4:38248716-38248738 | TCAGGAGATCGAGACCATCCTGG | 0: 52576 1: 63017 2: 95022 3: 179642 4: 170031 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972352462 | Original CRISPR | GACTCATGATCAGCGCGCCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||