ID: 972352462

View in Genome Browser
Species Human (GRCh38)
Location 4:38248695-38248717
Sequence GACTCATGATCAGCGCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972352462_972352465 7 Left 972352462 4:38248695-38248717 CCAAGGCGCGCTGATCATGAGTC No data
Right 972352465 4:38248725-38248747 CGAGACCATCCTGGCTAATATGG No data
972352462_972352464 -2 Left 972352462 4:38248695-38248717 CCAAGGCGCGCTGATCATGAGTC No data
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972352462 Original CRISPR GACTCATGATCAGCGCGCCT TGG (reversed) Intergenic