ID: 972352464

View in Genome Browser
Species Human (GRCh38)
Location 4:38248716-38248738
Sequence TCAGGAGATCGAGACCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 560288
Summary {0: 52576, 1: 63017, 2: 95022, 3: 179642, 4: 170031}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972352457_972352464 23 Left 972352457 4:38248670-38248692 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031
972352462_972352464 -2 Left 972352462 4:38248695-38248717 CCAAGGCGCGCTGATCATGAGTC No data
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031
972352461_972352464 14 Left 972352461 4:38248679-38248701 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031
972352459_972352464 15 Left 972352459 4:38248678-38248700 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 972352464 4:38248716-38248738 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972352464 Original CRISPR TCAGGAGATCGAGACCATCC TGG Intergenic
Too many off-targets to display for this crispr