ID: 972352465 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:38248725-38248747 |
| Sequence | CGAGACCATCCTGGCTAATA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972352461_972352465 | 23 | Left | 972352461 | 4:38248679-38248701 | CCAGCACTTTGGGAGGCCAAGGC | No data | ||
| Right | 972352465 | 4:38248725-38248747 | CGAGACCATCCTGGCTAATATGG | No data | ||||
| 972352459_972352465 | 24 | Left | 972352459 | 4:38248678-38248700 | CCCAGCACTTTGGGAGGCCAAGG | No data | ||
| Right | 972352465 | 4:38248725-38248747 | CGAGACCATCCTGGCTAATATGG | No data | ||||
| 972352462_972352465 | 7 | Left | 972352462 | 4:38248695-38248717 | CCAAGGCGCGCTGATCATGAGTC | No data | ||
| Right | 972352465 | 4:38248725-38248747 | CGAGACCATCCTGGCTAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972352465 | Original CRISPR | CGAGACCATCCTGGCTAATA TGG | Intergenic | ||