ID: 972352465

View in Genome Browser
Species Human (GRCh38)
Location 4:38248725-38248747
Sequence CGAGACCATCCTGGCTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381861
Summary {0: 922, 1: 39336, 2: 59262, 3: 100394, 4: 181947}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972352461_972352465 23 Left 972352461 4:38248679-38248701 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 972352465 4:38248725-38248747 CGAGACCATCCTGGCTAATATGG 0: 922
1: 39336
2: 59262
3: 100394
4: 181947
972352462_972352465 7 Left 972352462 4:38248695-38248717 CCAAGGCGCGCTGATCATGAGTC No data
Right 972352465 4:38248725-38248747 CGAGACCATCCTGGCTAATATGG 0: 922
1: 39336
2: 59262
3: 100394
4: 181947
972352459_972352465 24 Left 972352459 4:38248678-38248700 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 972352465 4:38248725-38248747 CGAGACCATCCTGGCTAATATGG 0: 922
1: 39336
2: 59262
3: 100394
4: 181947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972352465 Original CRISPR CGAGACCATCCTGGCTAATA TGG Intergenic
Too many off-targets to display for this crispr