ID: 972355083

View in Genome Browser
Species Human (GRCh38)
Location 4:38272983-38273005
Sequence ACACATTGCATACACTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972355083_972355085 15 Left 972355083 4:38272983-38273005 CCTCTGCAGTGTATGCAATGTGT No data
Right 972355085 4:38273021-38273043 TCCATTTCTGTGCATTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972355083 Original CRISPR ACACATTGCATACACTGCAG AGG (reversed) Intergenic
No off target data available for this crispr