ID: 972362847

View in Genome Browser
Species Human (GRCh38)
Location 4:38344961-38344983
Sequence CTGTCATAGTGGAAGTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972362847_972362851 18 Left 972362847 4:38344961-38344983 CCCTTCAACTTCCACTATGACAG No data
Right 972362851 4:38345002-38345024 GTAGATTGTGGTTTTATCTATGG No data
972362847_972362850 6 Left 972362847 4:38344961-38344983 CCCTTCAACTTCCACTATGACAG No data
Right 972362850 4:38344990-38345012 TATGATCTGTTTGTAGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972362847 Original CRISPR CTGTCATAGTGGAAGTTGAA GGG (reversed) Intergenic
No off target data available for this crispr