ID: 972364303

View in Genome Browser
Species Human (GRCh38)
Location 4:38359976-38359998
Sequence CAATAGGCACAGAGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972364303_972364310 15 Left 972364303 4:38359976-38359998 CCATCCCCACTCTGTGCCTATTG No data
Right 972364310 4:38360014-38360036 GTCATGCTCCCAGGCTTTAATGG No data
972364303_972364313 27 Left 972364303 4:38359976-38359998 CCATCCCCACTCTGTGCCTATTG No data
Right 972364313 4:38360026-38360048 GGCTTTAATGGATACAGTTGAGG No data
972364303_972364309 6 Left 972364303 4:38359976-38359998 CCATCCCCACTCTGTGCCTATTG No data
Right 972364309 4:38360005-38360027 CGTGAGATTGTCATGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972364303 Original CRISPR CAATAGGCACAGAGTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr