ID: 972364303 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:38359976-38359998 |
Sequence | CAATAGGCACAGAGTGGGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972364303_972364310 | 15 | Left | 972364303 | 4:38359976-38359998 | CCATCCCCACTCTGTGCCTATTG | No data | ||
Right | 972364310 | 4:38360014-38360036 | GTCATGCTCCCAGGCTTTAATGG | No data | ||||
972364303_972364313 | 27 | Left | 972364303 | 4:38359976-38359998 | CCATCCCCACTCTGTGCCTATTG | No data | ||
Right | 972364313 | 4:38360026-38360048 | GGCTTTAATGGATACAGTTGAGG | No data | ||||
972364303_972364309 | 6 | Left | 972364303 | 4:38359976-38359998 | CCATCCCCACTCTGTGCCTATTG | No data | ||
Right | 972364309 | 4:38360005-38360027 | CGTGAGATTGTCATGCTCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972364303 | Original CRISPR | CAATAGGCACAGAGTGGGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |