ID: 972366736

View in Genome Browser
Species Human (GRCh38)
Location 4:38382883-38382905
Sequence CTCAGCAGCAATGCTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972366736_972366740 25 Left 972366736 4:38382883-38382905 CCCCCAAAAGCATTGCTGCTGAG No data
Right 972366740 4:38382931-38382953 TAGCTTTATTATGAAATTTGAGG No data
972366736_972366742 30 Left 972366736 4:38382883-38382905 CCCCCAAAAGCATTGCTGCTGAG No data
Right 972366742 4:38382936-38382958 TTATTATGAAATTTGAGGGTTGG No data
972366736_972366741 26 Left 972366736 4:38382883-38382905 CCCCCAAAAGCATTGCTGCTGAG No data
Right 972366741 4:38382932-38382954 AGCTTTATTATGAAATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972366736 Original CRISPR CTCAGCAGCAATGCTTTTGG GGG (reversed) Intergenic
No off target data available for this crispr