ID: 972366936

View in Genome Browser
Species Human (GRCh38)
Location 4:38384808-38384830
Sequence ATAAGCCAGCCTTGCAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972366936_972366940 27 Left 972366936 4:38384808-38384830 CCTAATTTGCAAGGCTGGCTTAT No data
Right 972366940 4:38384858-38384880 CCTACCCTTTGCCTCTTCATTGG No data
972366936_972366938 2 Left 972366936 4:38384808-38384830 CCTAATTTGCAAGGCTGGCTTAT No data
Right 972366938 4:38384833-38384855 GACAAGTTAAGGAATCATTAAGG No data
972366936_972366937 -9 Left 972366936 4:38384808-38384830 CCTAATTTGCAAGGCTGGCTTAT No data
Right 972366937 4:38384822-38384844 CTGGCTTATGAGACAAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972366936 Original CRISPR ATAAGCCAGCCTTGCAAATT AGG (reversed) Intergenic
No off target data available for this crispr