ID: 972370783

View in Genome Browser
Species Human (GRCh38)
Location 4:38421246-38421268
Sequence CTTCTGTTCTTGGGCATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972370783 Original CRISPR CTTCTGTTCTTGGGCATCAG TGG (reversed) Intergenic
900464211 1:2816564-2816586 CTTGTGTTTTTGGTCAGCAGAGG + Intergenic
901853732 1:12031351-12031373 CTTCTGGTGCTGGGCCTCAGCGG - Exonic
905876757 1:41436351-41436373 ATTCTGTTCTCTGGCACCAGTGG - Intergenic
905876891 1:41437371-41437393 ATTCTGTTCTATGGCACCAGTGG + Intergenic
905933068 1:41803335-41803357 CTGCTGGTCTTGGGCCCCAGAGG - Intronic
906166398 1:43689621-43689643 CTCCTGCTCTGGGGCATCTGTGG + Intronic
906903901 1:49867184-49867206 TTTCTGTTCTTTGGCATCCGTGG + Intronic
909687835 1:78371011-78371033 CTTCTGTTCTTGGTTATATGCGG - Intronic
910342989 1:86209245-86209267 TCTCTGTTGTTTGGCATCAGGGG + Intergenic
912651401 1:111442630-111442652 GTACTGTTCTTTGTCATCAGGGG - Intronic
912873136 1:113328120-113328142 CTTCTTTTCTTGGGAAGAAGGGG + Intergenic
918190252 1:182166912-182166934 CATCTGTTATTGGGAAACAGGGG - Intergenic
918374464 1:183895292-183895314 ATGCTGTTCTTGGGCTTCAGAGG - Intronic
919425279 1:197422087-197422109 CTTCTTTTCTTTCTCATCAGTGG - Intronic
921317977 1:213909878-213909900 CTTCTATTTTTGGTCATCAGAGG + Intergenic
922424698 1:225481990-225482012 CAGGTGTTCTTGGGCATCAGAGG - Intergenic
923894975 1:238259857-238259879 CTTCAGTTCTCAGGGATCAGGGG - Intergenic
1063322317 10:5061660-5061682 ATACTGTAATTGGGCATCAGAGG - Intronic
1063568840 10:7196015-7196037 TTTCTCTTCCTGGTCATCAGTGG - Intronic
1066505646 10:36039593-36039615 CTTCTCTTCTTGTGCATAAGGGG + Intergenic
1067745651 10:48933791-48933813 CTTGTGTTCTAGGGTTTCAGGGG + Intronic
1068200533 10:53778352-53778374 ATCCTGTTATTGGGCATTAGGGG + Intergenic
1073638136 10:105220390-105220412 TTTATCTTCTTGGGTATCAGAGG + Intronic
1075611416 10:123857749-123857771 CTCCTGTTCCTCGGCGTCAGTGG - Intronic
1076142911 10:128093767-128093789 CTTCTGTTCTTTAACAGCAGAGG + Intergenic
1079357640 11:19743290-19743312 CTTCTGAACTTGGGAGTCAGGGG + Intronic
1083020087 11:59497724-59497746 GTGCTGTTCTTGGCGATCAGAGG - Intergenic
1085169242 11:74434373-74434395 CTTCTGTTGATGGACATCTGGGG - Intergenic
1086210222 11:84309251-84309273 CGTCTGTCCTTGGGAATCACTGG + Intronic
1088068807 11:105755822-105755844 CTTCTGCCCTTGGACATCGGTGG + Intronic
1088171777 11:107006122-107006144 CTTGTTATCTTGGGCATCACTGG - Intronic
1089771800 11:120808536-120808558 CTTGAGTTCTTGGACACCAGGGG + Intronic
1091656529 12:2350597-2350619 CTTCAGTTCATGGGCATCAATGG - Intronic
1092823225 12:12373159-12373181 CTTCTGTTCTTAGCCATGTGAGG + Intronic
1096577661 12:52564075-52564097 TTTCTCCTCTTGGGCTTCAGGGG + Intergenic
1097477409 12:60075233-60075255 GTTCTCTTCTTTGGCACCAGTGG + Intergenic
1097695000 12:62767185-62767207 CTTCTATACTTGGGCAACATCGG + Intronic
1101293924 12:103401335-103401357 TTTCTATTCTTGGACATCAGTGG + Intronic
1106545289 13:30725813-30725835 CTTCTGATCATGGGCTTCACTGG + Intronic
1106917031 13:34526819-34526841 CTGCTGTTCGTGGGCTGCAGTGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1110120627 13:71875991-71876013 CTTCTTTTCTTAGTCATCAGAGG + Intergenic
1112206423 13:97328100-97328122 CTGCTGTTCTTGGGCACCTTGGG - Intronic
1113443129 13:110345428-110345450 CTGCTGTTCCTGGGAAGCAGTGG + Intronic
1117746599 14:58875859-58875881 CTTCTGCACTTGGGCTTAAGGGG + Intergenic
1118727029 14:68636212-68636234 CTCCTGTTCTCTGGAATCAGAGG - Intronic
1118833143 14:69453823-69453845 CTTTTGTTTTTGTGCAACAGTGG + Intronic
1119611528 14:76067194-76067216 CTTCTATCCCTAGGCATCAGAGG - Intronic
1123416034 15:20096150-20096172 CTTCTGTGCCTGGACAGCAGAGG + Intergenic
1123525372 15:21103259-21103281 CTTCTGTGCCTGGACAGCAGAGG + Intergenic
1124568652 15:30839248-30839270 CTTCTGTTTCTGTTCATCAGTGG + Intergenic
1126339753 15:47626248-47626270 CTTCTGTCCTTGGACATTTGGGG - Intronic
1131619843 15:94056350-94056372 TTTCTGATGGTGGGCATCAGAGG - Intergenic
1134016276 16:10890627-10890649 TTTCTGTTCTTTTGCATAAGGGG - Intronic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1141416903 16:83882741-83882763 CTTCTCTTCTTGGGAGACAGCGG - Intergenic
1146544664 17:33727935-33727957 CTTCTTTTCTTGGGCACCTTTGG + Intronic
1147890840 17:43715672-43715694 TTTGAGTTCTTTGGCATCAGAGG - Intergenic
1148396461 17:47311766-47311788 CTTTTTTTCTTGGGCATTTGGGG - Intronic
1149402674 17:56313991-56314013 TTTCAGTACTTGGTCATCAGGGG + Intronic
1149854579 17:60069428-60069450 CTCCTGGTCTTGAGCATCATGGG + Intronic
1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150712291 17:67542145-67542167 CTTCTTTTCTTGTGCCTCATTGG - Intronic
1151380494 17:73722398-73722420 TGTCTGTTCTAGGGTATCAGAGG - Intergenic
1152079052 17:78175234-78175256 CTTCAGTGCTTGTGAATCAGAGG - Intronic
1152169320 17:78733736-78733758 ATTCTGTTCTTGTCCATCTGGGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152973043 18:184215-184237 CTTCTTTTGTTTGGCATCAGAGG - Intronic
1153014188 18:568622-568644 TTTCTGTTCTGGGGCATCTCAGG - Intergenic
1153272824 18:3340415-3340437 CTCCTAGTCTTGGGCATGAGGGG - Intergenic
1156603207 18:38635331-38635353 CTTCTCTTCCTGGACCTCAGTGG - Intergenic
1158475762 18:57778046-57778068 CTTCTGTTGTTGACCATCACTGG - Intronic
1159069206 18:63604781-63604803 CTCCAGTTCTTGAGCATCAGAGG - Intergenic
1161131656 19:2593223-2593245 CTTCTGGTCTTGGTCACCAACGG + Intronic
1161768539 19:6219448-6219470 CTTCTGTTCTTGGGGGCCAGGGG + Intronic
1162821584 19:13226579-13226601 CATCTGTCCTTGGGCACCAAGGG + Intronic
1163545079 19:17936494-17936516 CTTCTGCTTCTTGGCATCAGCGG - Exonic
1165303179 19:34985638-34985660 ATGCTGTTCTTGGCCATCTGGGG - Intergenic
1165795887 19:38518961-38518983 CGTCTGTTGTTGGGGGTCAGAGG + Intronic
1168280590 19:55303475-55303497 CTTCTTTCCTTGGGAATCTGGGG - Intronic
925268162 2:2581757-2581779 CATCTATTCTAGGGCATTAGTGG - Intergenic
925426197 2:3750712-3750734 TTTCTGTTCTTTGGCATCCATGG + Intronic
928040682 2:27873307-27873329 CTGCTATTCTTGGGCAACTGTGG + Intronic
928046618 2:27940767-27940789 TTTCTGCCCTTGGGCATCATAGG - Intronic
931121477 2:59225204-59225226 CTTCTGTTAAAGGGCAGCAGGGG - Intergenic
931172397 2:59817286-59817308 CTTTTATTCTTGGGCTTCAGAGG - Intergenic
931219819 2:60278764-60278786 GTTCTGGCCTTGGGCAGCAGGGG + Intergenic
934476850 2:94599328-94599350 CTTCTGTCCTGGGGCTTCTGAGG + Intronic
938953417 2:136278033-136278055 CTTCTGTTCCTGGGCAATAAGGG + Intergenic
941030008 2:160500167-160500189 CTTCTGCTCTTGGCCATGTGAGG + Intergenic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
944446874 2:199801074-199801096 CTTCTGATGCTGGGCACCAGAGG + Intronic
948092386 2:235305383-235305405 CTTGTCTTCTTGGGCAAAAGGGG + Intergenic
948119538 2:235518898-235518920 CTCCTGTCCTTGGGCCTCAGTGG + Intronic
1173188343 20:40858086-40858108 CTTGTGTTCTTGGCTATCAAAGG + Intergenic
1175161342 20:57010005-57010027 CTCCCGTCCTGGGGCATCAGGGG - Intergenic
1177038015 21:16069567-16069589 CTTCTCTTCCTGGTCATCATAGG + Intergenic
1177203201 21:17980650-17980672 CTTCTGTTCTTGGGTTTCACGGG + Intronic
1179414100 21:41184607-41184629 CTCATTTTCTTGGGCAGCAGAGG + Intronic
1181902011 22:26164050-26164072 GTTATGTTCTTGGGCCTCAAAGG - Intergenic
1182449227 22:30408837-30408859 CGTCTGTCCTCGGGCATAAGTGG + Intronic
1182543657 22:31059850-31059872 CTTCTGTGCCTGGACAGCAGAGG - Intergenic
1183067038 22:35370397-35370419 CTTCAGCTCATGGCCATCAGGGG - Intergenic
1183286630 22:36969402-36969424 CTCCTGTGGTTGGGCACCAGTGG + Intergenic
1183729842 22:39611946-39611968 CCTCTGTTCTTTGGCCTCATAGG + Intronic
951630860 3:24718488-24718510 TTTGTATTCTTGGACATCAGTGG + Intergenic
952690585 3:36200596-36200618 CTTCTGTCCCTAGGCAACAGAGG + Intergenic
954094987 3:48319151-48319173 TTTCTGTTCTTTGGCCTGAGGGG + Intronic
954955578 3:54515928-54515950 CACCTGTTCCTGGGCCTCAGTGG + Intronic
956272658 3:67464273-67464295 TTTCTGTTTTTGGGCATGTGAGG - Intronic
956845626 3:73179696-73179718 CCTCTGTTCTTGTCCATCAAAGG - Intergenic
958736963 3:98020643-98020665 CTCCAGTGCTTGGGCAACAGTGG - Intronic
960430779 3:117565936-117565958 CTTTTGTTCTCTGGAATCAGAGG + Intergenic
960661326 3:120062693-120062715 CTTCTGATCTTGTTCATCACTGG - Intronic
961867432 3:129963949-129963971 CCTCTGTACTGGGGCCTCAGGGG - Intergenic
963805515 3:149717625-149717647 CTTCACTTCTTGGGCACCAGAGG - Intronic
964306642 3:155347931-155347953 CTACAGTTCTGGGGCCTCAGGGG + Intergenic
965123128 3:164589435-164589457 GTTCTGTTTTTAGGTATCAGAGG + Intergenic
966238171 3:177725967-177725989 CTTCTTTTCTTTGGCATTAAGGG + Intergenic
967258259 3:187615479-187615501 CTTCTGTTCTTTGAGATCAGTGG - Intergenic
967558949 3:190895595-190895617 CCTCTGTTCTAGGGAATCTGTGG + Intergenic
967845272 3:194037980-194038002 CTTCTGTTCCTGGGCTCAAGTGG + Intergenic
968482305 4:839625-839647 CTTCTGCTTTTGGCCATGAGTGG - Intergenic
968571772 4:1346079-1346101 CTTCTGTCCCTGGGCGTCAGTGG - Intergenic
968750900 4:2388466-2388488 CTTCCCTTCTTGTGCAGCAGTGG - Intronic
970465924 4:16323047-16323069 CTTCTATTCGTGGGCATAATGGG + Intergenic
970528024 4:16952578-16952600 TTTCTGTTCCTGGGAATCAGCGG - Intergenic
972370783 4:38421246-38421268 CTTCTGTTCTTGGGCATCAGTGG - Intergenic
974941190 4:68470339-68470361 CTTCTTATCTTTTGCATCAGTGG - Intronic
977830259 4:101582574-101582596 AGTCAGTTCTTGGGCAACAGTGG + Intronic
980088341 4:128415861-128415883 CATCTGTTTTTGGGCTACAGTGG + Intergenic
980614994 4:135208162-135208184 ATTCTGTCATTGGGCATAAGTGG + Intergenic
980857157 4:138454091-138454113 CTTCTGTTCCTTGGCAGCATGGG + Intergenic
983636291 4:169900905-169900927 CTTCTGTTCTGGTGCACAAGTGG - Intergenic
985836005 5:2272336-2272358 CGTGTGTTCTTGGGCCCCAGTGG + Intergenic
986574898 5:9201878-9201900 CTTCTGTTCTTTGACCTCTGAGG - Intronic
986596679 5:9429957-9429979 CTTCTGCTCTTGGGCCTCCGTGG - Intronic
986843494 5:11725221-11725243 TTTCTGTTGCTGGGCATCAGTGG - Intronic
990957613 5:61359344-61359366 CTTGTGACCTTGGGCATCACTGG + Intronic
991095269 5:62733072-62733094 CTTCTGTTCTTGTGGACCAGTGG + Intergenic
991121014 5:63013651-63013673 CTTCTGTTCTTGTAGATCATAGG + Intergenic
993806370 5:92415721-92415743 CTTTTGGTCCTGGGCATCTGTGG + Intergenic
996304204 5:122028033-122028055 CTTCTTTGCTTAGCCATCAGTGG - Exonic
997205802 5:132049156-132049178 CTTGTGCTCTTGGGCTTCACAGG + Intergenic
997523451 5:134537915-134537937 TTCCTATTCTTGGGCATGAGTGG + Intronic
1001559860 5:172661925-172661947 CTTCTGTCCTTGGACACCAAGGG + Intronic
1003779756 6:9411436-9411458 CCTCTCTTCTTGGCCATCTGTGG - Intergenic
1010113832 6:72276214-72276236 TTTCTTTTCTTGGGGATCGGAGG - Intronic
1013576949 6:111493221-111493243 ATTCTGTTGTTGGCCAACAGTGG - Intergenic
1017118278 6:150999453-150999475 CTTCTGCTCTTGGCCAACAGTGG - Intronic
1017804927 6:157936558-157936580 GATCTGTTCTTAGCCATCAGGGG + Intronic
1019587864 7:1814731-1814753 CTTCTGTTCCTGGGCGCAAGGGG - Intergenic
1021406379 7:20272037-20272059 CTTCTGTTTTTCTGCTTCAGGGG - Intergenic
1022841303 7:34166512-34166534 CAGCTGTACTTGGGCATCAGGGG + Intergenic
1027994863 7:85413056-85413078 ATTGTGATCTTGGGCAACAGAGG + Intergenic
1028500632 7:91515281-91515303 GTTCTGTTTTTGGCCTTCAGGGG + Intergenic
1029557845 7:101282763-101282785 CCTCTGTTTTTGGACAGCAGTGG - Intergenic
1030529374 7:110693956-110693978 CTTCCCTTCTTGGGGAACAGAGG + Intronic
1031018525 7:116601348-116601370 CTTCTGTTCATGGTGAACAGAGG + Intergenic
1032267838 7:130381124-130381146 CTTCTGTACCTGGGCCTCATCGG - Exonic
1034153477 7:148935521-148935543 CTTCTGTTGCTGGGCATCCCAGG - Intergenic
1035726247 8:1825535-1825557 CTTGGCTTCTTGGGCACCAGCGG - Intronic
1041257893 8:55995186-55995208 CTGCTGTTTCTGGGCAGCAGAGG + Intronic
1043095994 8:75973532-75973554 AATCTGTTCTTGGGATTCAGAGG - Intergenic
1043326957 8:79064071-79064093 TTACTGTGCTTAGGCATCAGTGG + Intergenic
1044945056 8:97381906-97381928 CTACTGATATTGGACATCAGTGG - Intergenic
1049564803 8:143332444-143332466 CTTCTGTCCTTGTGCGTCTGGGG - Intronic
1049867089 8:144946303-144946325 CTTCAGGTCTTGGGCTGCAGGGG - Intronic
1052360307 9:27548788-27548810 CTCCTGTTAGGGGGCATCAGTGG - Intronic
1052751515 9:32496509-32496531 CTTTTGCCCTTGGACATCAGAGG + Intronic
1052853178 9:33390581-33390603 CTTCTGTCCTGGGGCTTCTGAGG - Intronic
1053931203 9:43115081-43115103 CTTCTGTCCTGGGGCTTCTGAGG - Intergenic
1056117782 9:83458299-83458321 TCTCTGTTCTTTGGCTTCAGTGG - Intronic
1056706234 9:88954694-88954716 CTTCTTTTCTTGGGCTTAATTGG - Intergenic
1061974070 9:134059597-134059619 CTCCTTTTCTTGGGGAACAGGGG + Intronic
1185764009 X:2709916-2709938 CATCTGTCCCTGGGCCTCAGGGG - Intronic
1189261933 X:39685569-39685591 CTTCTGTTCTTGGGAACTTGGGG - Intergenic
1189349852 X:40268003-40268025 CTTCTGCTTTTAGGCCTCAGAGG + Intergenic
1192169560 X:68845865-68845887 CTTCAGTTCCAGGGCACCAGGGG + Intergenic
1193227038 X:78995899-78995921 CTTCTGCCCTGGGGCATCACAGG - Intergenic
1193828412 X:86256354-86256376 ATTCTCATCTTGGACATCAGTGG - Intronic
1199293559 X:146132116-146132138 CTTCTGACCTCAGGCATCAGAGG - Intergenic
1201607933 Y:15808522-15808544 CTTCTGGTCTTTAGCTTCAGTGG - Intergenic