ID: 972371332

View in Genome Browser
Species Human (GRCh38)
Location 4:38426315-38426337
Sequence CTCAAGAAAGAGATTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972371332_972371335 9 Left 972371332 4:38426315-38426337 CCATGCTCAATCTCTTTCTTGAG No data
Right 972371335 4:38426347-38426369 TCATACCAAATTTGTTCACCTGG No data
972371332_972371337 20 Left 972371332 4:38426315-38426337 CCATGCTCAATCTCTTTCTTGAG No data
Right 972371337 4:38426358-38426380 TTGTTCACCTGGATGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972371332 Original CRISPR CTCAAGAAAGAGATTGAGCA TGG (reversed) Intergenic
No off target data available for this crispr