ID: 972371717

View in Genome Browser
Species Human (GRCh38)
Location 4:38430512-38430534
Sequence CTGAAGAAATGGTGCCAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972371712_972371717 20 Left 972371712 4:38430469-38430491 CCCTTTCATTTCTGATCAGCTTG No data
Right 972371717 4:38430512-38430534 CTGAAGAAATGGTGCCAAATTGG No data
972371713_972371717 19 Left 972371713 4:38430470-38430492 CCTTTCATTTCTGATCAGCTTGG No data
Right 972371717 4:38430512-38430534 CTGAAGAAATGGTGCCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972371717 Original CRISPR CTGAAGAAATGGTGCCAAAT TGG Intergenic
No off target data available for this crispr