ID: 972373973

View in Genome Browser
Species Human (GRCh38)
Location 4:38453078-38453100
Sequence ACCTGGACCCTGCTACTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972373971_972373973 -4 Left 972373971 4:38453059-38453081 CCAGTGGTCAGTAGAAAGAACCT No data
Right 972373973 4:38453078-38453100 ACCTGGACCCTGCTACTAACTGG No data
972373969_972373973 17 Left 972373969 4:38453038-38453060 CCATTTTGTAAATTAGCTTTACC No data
Right 972373973 4:38453078-38453100 ACCTGGACCCTGCTACTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972373973 Original CRISPR ACCTGGACCCTGCTACTAAC TGG Intergenic
No off target data available for this crispr