ID: 972374808

View in Genome Browser
Species Human (GRCh38)
Location 4:38460299-38460321
Sequence CAGAGGAAGAAGTAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972374808_972374821 23 Left 972374808 4:38460299-38460321 CCAGCCACCTACTTCTTCCTCTG No data
Right 972374821 4:38460345-38460367 AGAAGAGCAACAGCTGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972374808 Original CRISPR CAGAGGAAGAAGTAGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr