ID: 972379920

View in Genome Browser
Species Human (GRCh38)
Location 4:38510127-38510149
Sequence CTGCAGGTTGACCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972379915_972379920 0 Left 972379915 4:38510104-38510126 CCTGGCTCCAGCCTCATCTGCTG No data
Right 972379920 4:38510127-38510149 CTGCAGGTTGACCTGGAGCCTGG No data
972379916_972379920 -7 Left 972379916 4:38510111-38510133 CCAGCCTCATCTGCTGCTGCAGG No data
Right 972379920 4:38510127-38510149 CTGCAGGTTGACCTGGAGCCTGG No data
972379914_972379920 1 Left 972379914 4:38510103-38510125 CCCTGGCTCCAGCCTCATCTGCT No data
Right 972379920 4:38510127-38510149 CTGCAGGTTGACCTGGAGCCTGG No data
972379912_972379920 18 Left 972379912 4:38510086-38510108 CCTGAGTGAATTTCACTCCCTGG No data
Right 972379920 4:38510127-38510149 CTGCAGGTTGACCTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972379920 Original CRISPR CTGCAGGTTGACCTGGAGCC TGG Intergenic
No off target data available for this crispr