ID: 972389882

View in Genome Browser
Species Human (GRCh38)
Location 4:38604587-38604609
Sequence CTAGAGTTCAGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972389882_972389891 30 Left 972389882 4:38604587-38604609 CCATCTTCCCTCCTGAACTCTAG No data
Right 972389891 4:38604640-38604662 TCCACTCTGTGAGGCATCTCAGG No data
972389882_972389890 21 Left 972389882 4:38604587-38604609 CCATCTTCCCTCCTGAACTCTAG No data
Right 972389890 4:38604631-38604653 TTAGACAGCTCCACTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972389882 Original CRISPR CTAGAGTTCAGGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr