ID: 972392370

View in Genome Browser
Species Human (GRCh38)
Location 4:38625959-38625981
Sequence TCTAGCTATTCCTATGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972392370_972392375 19 Left 972392370 4:38625959-38625981 CCTAGAGCATAGGAATAGCTAGA No data
Right 972392375 4:38626001-38626023 TCAATCCATAAACAAGGCTGAGG No data
972392370_972392373 13 Left 972392370 4:38625959-38625981 CCTAGAGCATAGGAATAGCTAGA No data
Right 972392373 4:38625995-38626017 CAAACCTCAATCCATAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972392370 Original CRISPR TCTAGCTATTCCTATGCTCT AGG (reversed) Intergenic
No off target data available for this crispr