ID: 972393129

View in Genome Browser
Species Human (GRCh38)
Location 4:38631945-38631967
Sequence CACTTAAACCCGGGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972393122_972393129 9 Left 972393122 4:38631913-38631935 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 972393129 4:38631945-38631967 CACTTAAACCCGGGAGGAGGAGG No data
972393124_972393129 8 Left 972393124 4:38631914-38631936 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 972393129 4:38631945-38631967 CACTTAAACCCGGGAGGAGGAGG No data
972393119_972393129 17 Left 972393119 4:38631905-38631927 CCTGTCCTCCCAGCTACTCGGGA 0: 2
1: 1218
2: 107318
3: 297899
4: 234821
Right 972393129 4:38631945-38631967 CACTTAAACCCGGGAGGAGGAGG No data
972393121_972393129 12 Left 972393121 4:38631910-38631932 CCTCCCAGCTACTCGGGAGGCTG 0: 55
1: 228
2: 324
3: 407
4: 680
Right 972393129 4:38631945-38631967 CACTTAAACCCGGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972393129 Original CRISPR CACTTAAACCCGGGAGGAGG AGG Intergenic
No off target data available for this crispr