ID: 972396006

View in Genome Browser
Species Human (GRCh38)
Location 4:38660492-38660514
Sequence TTTGCCAGTGACTGGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972396006_972396012 -8 Left 972396006 4:38660492-38660514 CCCTCCAACCAGTCACTGGCAAA No data
Right 972396012 4:38660507-38660529 CTGGCAAAAGACACTGGGATTGG No data
972396006_972396015 7 Left 972396006 4:38660492-38660514 CCCTCCAACCAGTCACTGGCAAA No data
Right 972396015 4:38660522-38660544 GGGATTGGCTGGGAGTAACCAGG No data
972396006_972396014 -3 Left 972396006 4:38660492-38660514 CCCTCCAACCAGTCACTGGCAAA No data
Right 972396014 4:38660512-38660534 AAAAGACACTGGGATTGGCTGGG No data
972396006_972396017 20 Left 972396006 4:38660492-38660514 CCCTCCAACCAGTCACTGGCAAA No data
Right 972396017 4:38660535-38660557 AGTAACCAGGGTTCCTCTGCTGG No data
972396006_972396016 8 Left 972396006 4:38660492-38660514 CCCTCCAACCAGTCACTGGCAAA No data
Right 972396016 4:38660523-38660545 GGATTGGCTGGGAGTAACCAGGG No data
972396006_972396020 27 Left 972396006 4:38660492-38660514 CCCTCCAACCAGTCACTGGCAAA No data
Right 972396020 4:38660542-38660564 AGGGTTCCTCTGCTGGGACCAGG No data
972396006_972396018 21 Left 972396006 4:38660492-38660514 CCCTCCAACCAGTCACTGGCAAA No data
Right 972396018 4:38660536-38660558 GTAACCAGGGTTCCTCTGCTGGG No data
972396006_972396013 -4 Left 972396006 4:38660492-38660514 CCCTCCAACCAGTCACTGGCAAA No data
Right 972396013 4:38660511-38660533 CAAAAGACACTGGGATTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972396006 Original CRISPR TTTGCCAGTGACTGGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr