ID: 972396518

View in Genome Browser
Species Human (GRCh38)
Location 4:38663730-38663752
Sequence CGCCGCCGCCCGAGCCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972396518_972396536 10 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396536 4:38663763-38663785 GCCGGGCGGGAGGGCTGGCGGGG No data
972396518_972396542 27 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396542 4:38663780-38663802 GCGGGGCGCGGACTCCGGGGAGG 0: 1
1: 0
2: 3
3: 42
4: 326
972396518_972396541 24 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396541 4:38663777-38663799 CTGGCGGGGCGCGGACTCCGGGG No data
972396518_972396543 30 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396543 4:38663783-38663805 GGGCGCGGACTCCGGGGAGGAGG No data
972396518_972396535 9 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396535 4:38663762-38663784 GGCCGGGCGGGAGGGCTGGCGGG No data
972396518_972396534 8 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396534 4:38663761-38663783 GGGCCGGGCGGGAGGGCTGGCGG No data
972396518_972396538 15 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396538 4:38663768-38663790 GCGGGAGGGCTGGCGGGGCGCGG No data
972396518_972396532 1 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396532 4:38663754-38663776 GGCGGCTGGGCCGGGCGGGAGGG 0: 1
1: 0
2: 12
3: 104
4: 964
972396518_972396528 -7 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396528 4:38663746-38663768 GGCGGCGCGGCGGCTGGGCCGGG No data
972396518_972396540 23 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396540 4:38663776-38663798 GCTGGCGGGGCGCGGACTCCGGG No data
972396518_972396529 -4 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396529 4:38663749-38663771 GGCGCGGCGGCTGGGCCGGGCGG No data
972396518_972396531 0 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396531 4:38663753-38663775 CGGCGGCTGGGCCGGGCGGGAGG No data
972396518_972396530 -3 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396530 4:38663750-38663772 GCGCGGCGGCTGGGCCGGGCGGG No data
972396518_972396533 5 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396533 4:38663758-38663780 GCTGGGCCGGGCGGGAGGGCTGG No data
972396518_972396539 22 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396539 4:38663775-38663797 GGCTGGCGGGGCGCGGACTCCGG No data
972396518_972396527 -8 Left 972396518 4:38663730-38663752 CCCCCCGGGCTCGGGCGGCGGCG No data
Right 972396527 4:38663745-38663767 CGGCGGCGCGGCGGCTGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972396518 Original CRISPR CGCCGCCGCCCGAGCCCGGG GGG (reversed) Intergenic
No off target data available for this crispr