ID: 972396520

View in Genome Browser
Species Human (GRCh38)
Location 4:38663732-38663754
Sequence CGCGCCGCCGCCCGAGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972396520_972396532 -1 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396532 4:38663754-38663776 GGCGGCTGGGCCGGGCGGGAGGG 0: 1
1: 0
2: 12
3: 104
4: 964
972396520_972396540 21 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396540 4:38663776-38663798 GCTGGCGGGGCGCGGACTCCGGG No data
972396520_972396531 -2 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396531 4:38663753-38663775 CGGCGGCTGGGCCGGGCGGGAGG No data
972396520_972396529 -6 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396529 4:38663749-38663771 GGCGCGGCGGCTGGGCCGGGCGG No data
972396520_972396534 6 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396534 4:38663761-38663783 GGGCCGGGCGGGAGGGCTGGCGG No data
972396520_972396530 -5 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396530 4:38663750-38663772 GCGCGGCGGCTGGGCCGGGCGGG No data
972396520_972396539 20 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396539 4:38663775-38663797 GGCTGGCGGGGCGCGGACTCCGG No data
972396520_972396544 29 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396544 4:38663784-38663806 GGCGCGGACTCCGGGGAGGAGGG No data
972396520_972396541 22 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396541 4:38663777-38663799 CTGGCGGGGCGCGGACTCCGGGG No data
972396520_972396543 28 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396543 4:38663783-38663805 GGGCGCGGACTCCGGGGAGGAGG No data
972396520_972396533 3 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396533 4:38663758-38663780 GCTGGGCCGGGCGGGAGGGCTGG No data
972396520_972396542 25 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396542 4:38663780-38663802 GCGGGGCGCGGACTCCGGGGAGG 0: 1
1: 0
2: 3
3: 42
4: 326
972396520_972396538 13 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396538 4:38663768-38663790 GCGGGAGGGCTGGCGGGGCGCGG No data
972396520_972396527 -10 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396527 4:38663745-38663767 CGGCGGCGCGGCGGCTGGGCCGG No data
972396520_972396528 -9 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396528 4:38663746-38663768 GGCGGCGCGGCGGCTGGGCCGGG No data
972396520_972396535 7 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396535 4:38663762-38663784 GGCCGGGCGGGAGGGCTGGCGGG No data
972396520_972396536 8 Left 972396520 4:38663732-38663754 CCCCGGGCTCGGGCGGCGGCGCG No data
Right 972396536 4:38663763-38663785 GCCGGGCGGGAGGGCTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972396520 Original CRISPR CGCGCCGCCGCCCGAGCCCG GGG (reversed) Intergenic
No off target data available for this crispr