ID: 972396521

View in Genome Browser
Species Human (GRCh38)
Location 4:38663733-38663755
Sequence CCGCGCCGCCGCCCGAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 14, 3: 68, 4: 493}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972396521_972396532 -2 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396532 4:38663754-38663776 GGCGGCTGGGCCGGGCGGGAGGG 0: 1
1: 0
2: 12
3: 104
4: 964
972396521_972396538 12 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396538 4:38663768-38663790 GCGGGAGGGCTGGCGGGGCGCGG No data
972396521_972396543 27 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396543 4:38663783-38663805 GGGCGCGGACTCCGGGGAGGAGG No data
972396521_972396530 -6 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396530 4:38663750-38663772 GCGCGGCGGCTGGGCCGGGCGGG No data
972396521_972396535 6 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396535 4:38663762-38663784 GGCCGGGCGGGAGGGCTGGCGGG No data
972396521_972396536 7 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396536 4:38663763-38663785 GCCGGGCGGGAGGGCTGGCGGGG No data
972396521_972396544 28 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396544 4:38663784-38663806 GGCGCGGACTCCGGGGAGGAGGG No data
972396521_972396528 -10 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396528 4:38663746-38663768 GGCGGCGCGGCGGCTGGGCCGGG No data
972396521_972396541 21 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396541 4:38663777-38663799 CTGGCGGGGCGCGGACTCCGGGG No data
972396521_972396534 5 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396534 4:38663761-38663783 GGGCCGGGCGGGAGGGCTGGCGG No data
972396521_972396539 19 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396539 4:38663775-38663797 GGCTGGCGGGGCGCGGACTCCGG No data
972396521_972396531 -3 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396531 4:38663753-38663775 CGGCGGCTGGGCCGGGCGGGAGG No data
972396521_972396529 -7 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396529 4:38663749-38663771 GGCGCGGCGGCTGGGCCGGGCGG No data
972396521_972396533 2 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396533 4:38663758-38663780 GCTGGGCCGGGCGGGAGGGCTGG No data
972396521_972396542 24 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396542 4:38663780-38663802 GCGGGGCGCGGACTCCGGGGAGG 0: 1
1: 0
2: 3
3: 42
4: 326
972396521_972396540 20 Left 972396521 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG 0: 1
1: 0
2: 14
3: 68
4: 493
Right 972396540 4:38663776-38663798 GCTGGCGGGGCGCGGACTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972396521 Original CRISPR CCGCGCCGCCGCCCGAGCCC GGG (reversed) Intergenic
900088674 1:909972-909994 CCGCGCCGCCGCCCCTGCCCAGG - Intergenic
900091751 1:923866-923888 CCGCGCCGCCCGCCGCGCCGGGG + Intergenic
900191771 1:1355147-1355169 CCGCGCCCCCTCCGCAGCCCCGG - Exonic
900313320 1:2045049-2045071 CCGCGCAGCTCCCCGAGGCCAGG + Intergenic
900342230 1:2194659-2194681 CCGCGCCCCCGCCCGGCTCCCGG + Intronic
900386337 1:2412655-2412677 CCCCGCTTCCGCCCGGGCCCTGG - Intronic
900460586 1:2800654-2800676 CACCGCCGCCCCCCGAGCCTGGG + Intronic
900512520 1:3067385-3067407 CCAGCTCGCCGCCCGAGCCCCGG - Intergenic
901005642 1:6170433-6170455 CCGCTCAGCCACCAGAGCCCCGG - Intronic
901019757 1:6249699-6249721 CCGCGCCGCCGCCCCGGGCCCGG - Exonic
901021878 1:6260191-6260213 CCGGGGCGCAGCCAGAGCCCGGG - Intronic
901433998 1:9235085-9235107 CCCCGCCGCCGCCCCGGCCCCGG + Intronic
901443436 1:9293062-9293084 CCGCGCCGCCTACCGCGCCCGGG - Exonic
901489453 1:9589174-9589196 CGCCGCCGCCCCCCGAGACCGGG + Intronic
901762280 1:11479032-11479054 CCGCGCTGCCGCCCAATCCCTGG - Intergenic
903153286 1:21428209-21428231 CTCCGCCGCCGCCCGCGCTCCGG - Intergenic
903263536 1:22143418-22143440 CCCGGCCGCCGCCCGGGCCTAGG + Intronic
903555069 1:24187262-24187284 CGGCGTCCCCGCCCGGGCCCAGG + Intronic
903597018 1:24502795-24502817 CGGCGCAGGCGCCAGAGCCCAGG - Intronic
903724353 1:25430166-25430188 CCGCACCGCCGCACACGCCCCGG + Intronic
903777153 1:25800388-25800410 CCGCGCGGCCGCCTGGGCCTCGG - Exonic
903778723 1:25808815-25808837 GGGCCCCTCCGCCCGAGCCCAGG + Intronic
903855751 1:26336810-26336832 CCGCCCCGCTCCCGGAGCCCGGG + Intronic
903883792 1:26529856-26529878 CTGCGCCGCCTCCCGGGTCCTGG - Intronic
904541981 1:31239544-31239566 CCGCGCAGCCCCCGGAGCCATGG - Exonic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
905037828 1:34929348-34929370 CCCCGGCGCCGCCCACGCCCCGG - Intronic
905449113 1:38046029-38046051 AGCCGCCGCCGCCCGCGCCCGGG + Exonic
905846900 1:41241626-41241648 TCGCGCCGCCGCCCGGCCCTCGG + Intronic
906293021 1:44632093-44632115 GCGCGGTGCCGCCCCAGCCCTGG - Intronic
906318016 1:44800522-44800544 CCGCTCCCCCGGCCGGGCCCGGG + Exonic
906653749 1:47533231-47533253 GCGCGCCTCCCCCCGAGTCCCGG - Intergenic
907038331 1:51236340-51236362 CCCCGCCGACGCCGGAGCCACGG - Exonic
907069337 1:51519425-51519447 CCGCGGCGCCGCCCAAACCCTGG + Intergenic
907213516 1:52842981-52843003 CCGCGTCGCCGCCCGCACCCCGG - Intronic
907501953 1:54887376-54887398 CCCCGCCGCCGCGCGAGGCGGGG + Intergenic
908534685 1:65066871-65066893 CCCCGCCCCCGCCCGCGTCCAGG - Intergenic
909957768 1:81800985-81801007 CCGCCCCGCCGGCGGAGCCGGGG + Intronic
911133799 1:94418316-94418338 CCGCCGCGCCGCCCGCGCTCTGG - Intergenic
911176258 1:94820648-94820670 CCCCGCCTCCGCCCCAGCACTGG - Intronic
911208696 1:95117782-95117804 CCGGGCCGCCTCCCGCGCGCCGG - Intronic
912416226 1:109509742-109509764 CGTCGCCGCCGCCGGAGCCTCGG + Intergenic
912568841 1:110607310-110607332 CCCCGCCGCCGCCCGCTGCCGGG - Exonic
912800187 1:112715326-112715348 CCGCGGCCCCGCCCCCGCCCAGG + Exonic
914702745 1:150149707-150149729 CCGAGCCGCCGCCGGAGCGAGGG + Intronic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
916483388 1:165235609-165235631 CCGCGCCGCCGCGCGTTCCCAGG - Intronic
916729473 1:167553435-167553457 GCACGCCGCTGCCCGCGCCCGGG + Exonic
919916874 1:202144402-202144424 CCGACCCGCGGCCCGCGCCCGGG + Intronic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
922234558 1:223713021-223713043 CCTCCGCGCCGCCAGAGCCCGGG + Intronic
922718254 1:227887775-227887797 CGGTGCCGCCGCCCCTGCCCAGG - Intergenic
923631153 1:235650099-235650121 CCCCGCCCCCGCCCCAGCCCGGG + Intronic
923728033 1:236524077-236524099 CTGCCCCGCCACCCGAGGCCGGG - Intronic
924172531 1:241357072-241357094 CCTCGCCGCCGCCCGTGCACAGG + Exonic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
1063201105 10:3785727-3785749 CCCTGTCGCCGCGCGAGCCCCGG + Intergenic
1063418339 10:5890595-5890617 CCGCGCTGCCCCCCGAGGCCAGG + Intronic
1064274197 10:13891771-13891793 CCCCGCCGCCGCCCCCGCCGCGG + Intronic
1064384586 10:14878969-14878991 CGGCCCCGCCGCCCGGGCCTTGG - Intronic
1064443186 10:15371315-15371337 CGCCGCCGCTGCCCGCGCCCAGG + Intergenic
1064622443 10:17229379-17229401 CCGCGCCACCGCCGCCGCCCAGG + Exonic
1068620623 10:59177145-59177167 CCGCGCCAAGGCGCGAGCCCCGG - Intronic
1069769347 10:70887919-70887941 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1070290709 10:75111653-75111675 CCGAGCCGCCGTCGGAGTCCGGG - Exonic
1070752780 10:78973863-78973885 CCGCGCCCCGGCCCCAGCCCCGG - Intergenic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071544861 10:86521569-86521591 GAGCGCCGCCGGCCGGGCCCAGG + Exonic
1072783963 10:98268151-98268173 CCGCGGCGCCCGCCCAGCCCCGG - Exonic
1073180386 10:101579721-101579743 CGGTGCCGCCGCCCTGGCCCTGG + Exonic
1075690232 10:124389321-124389343 CCGCCCCAGCTCCCGAGCCCCGG + Intergenic
1075748431 10:124743982-124744004 CGCCGCCGCCGCCCGGCCCCGGG + Intronic
1075802605 10:125161845-125161867 CCGGGCCGCCGCGCAAGCCCAGG - Intergenic
1076420745 10:130330014-130330036 CCGTGCCGGCTCCTGAGCCCAGG - Intergenic
1076721971 10:132396834-132396856 ACCCGCCGCGGCCGGAGCCCCGG - Intergenic
1076749889 10:132537420-132537442 CCGCCCCGCCCCCCGCGCCGCGG - Intergenic
1076898573 10:133325920-133325942 CGCCGCCGCCGCCCCAGCCTGGG + Exonic
1078091675 11:8268199-8268221 TCCCGCCGCCGCCGAAGCCCGGG + Intronic
1078190855 11:9091641-9091663 CCCGCCCGCCCCCCGAGCCCCGG + Intronic
1078225151 11:9384912-9384934 CCGCGCCTCCGGCCAGGCCCCGG - Intronic
1078371626 11:10751276-10751298 CCGCGGCGCCGCTGGAGCTCTGG - Exonic
1078474638 11:11620584-11620606 CCGCGGAGCCGCCCGGGACCGGG - Intronic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080012322 11:27471997-27472019 CCCCGCCGCCGCCCGGGCCTGGG - Intronic
1080283619 11:30585465-30585487 TCGGGCCGCCGCGGGAGCCCGGG + Intronic
1080387325 11:31817779-31817801 CCGGGCCGGGGCCGGAGCCCGGG + Intronic
1081545191 11:44066608-44066630 CCCCGCCGCCCCCCTACCCCAGG + Exonic
1082003713 11:47408556-47408578 CCGCCCGGCCGCCCGGCCCCCGG - Intronic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083659806 11:64246782-64246804 CCCCGCCGCCGCCCTCGCCGCGG - Exonic
1083885149 11:65569883-65569905 CCTCGCTGCCTCCCGAGGCCTGG - Intergenic
1084636756 11:70398288-70398310 CCGCGGCGCTGCCCGGGGCCGGG - Intergenic
1084978109 11:72814338-72814360 CCCCGCCGCCGCCCGCCCCCTGG + Exonic
1085011259 11:73142762-73142784 CCGCGCCGACGCACGCGCACAGG + Intergenic
1086064841 11:82733580-82733602 CAGCGCACCCGCCGGAGCCCCGG + Exonic
1087855959 11:103092017-103092039 CCCGGCCGCCGCCCGCTCCCAGG + Exonic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1088495801 11:110430240-110430262 CCGCGCTCCCGCCCGGCCCCCGG - Exonic
1089511173 11:118998190-118998212 CTGCGCCGGCGCCATAGCCCGGG - Exonic
1091434018 12:459903-459925 CCCCGCCCCCGCCCCCGCCCCGG - Intergenic
1091718433 12:2795594-2795616 CCGAGCCGCAGCCCGGGGCCAGG + Intronic
1091747122 12:2999599-2999621 CTGGGCCGGCTCCCGAGCCCGGG + Intronic
1091888079 12:4031265-4031287 CCGCGCCCCCGCCCGGGGCCGGG + Intergenic
1091973725 12:4809403-4809425 CTGCCCCGGCGCCCGAGCGCGGG - Exonic
1092253594 12:6914781-6914803 CTGCTCCGCCGCCCGCGCCCAGG + Intronic
1092899498 12:13044823-13044845 CCGTCCCGCCGCCCCCGCCCAGG - Intronic
1094807725 12:34108163-34108185 CTGCGCCGCCCTCCCAGCCCAGG - Intergenic
1096460832 12:51820841-51820863 CCGCGCCGCAGCCCCCGTCCAGG + Intergenic
1096502010 12:52069952-52069974 CCGCACCGCCCCCCGCGCGCCGG - Exonic
1096977489 12:55707845-55707867 CCACCCCGCCGCCCCAGCACCGG + Intronic
1097262320 12:57726665-57726687 CCGCGCTGCCGCCCTCACCCGGG + Exonic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1101910510 12:108857487-108857509 CCGCGCCGCAGCCATGGCCCTGG - Exonic
1102571651 12:113830555-113830577 CCGCCCCGCAGCCCTAGCTCAGG - Intronic
1102644635 12:114396183-114396205 CCCCGCGGCTGCCCGACCCCGGG + Intronic
1103623838 12:122204337-122204359 CCCCGCCGCCCTCCGAGCCGCGG - Intronic
1104049482 12:125186251-125186273 CCGGGCTGCCGCCTGTGCCCCGG + Intergenic
1104376184 12:128267098-128267120 CCCCGCCCCCGCCCCCGCCCGGG - Intergenic
1104935299 12:132361154-132361176 CCCCGCCACCCCCCCAGCCCTGG - Intergenic
1104983307 12:132583364-132583386 CCCCGCTGCCGCCCCCGCCCCGG + Exonic
1105071448 12:133236247-133236269 CTGCGCCGGCGCCAGAGCCAGGG - Intergenic
1105502886 13:20988342-20988364 CCCCGCCCCCGCCCCCGCCCCGG - Exonic
1106568511 13:30906694-30906716 CCGCGCCGCCGCCGGCTCCCCGG - Exonic
1107123402 13:36819414-36819436 CCACCCCGCGGCCCTAGCCCCGG + Exonic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112216355 13:97434394-97434416 CCGCGCTGCGCCCCCAGCCCCGG - Exonic
1113312037 13:109140999-109141021 CCCCGCCCCCGCCCCCGCCCGGG + Exonic
1113513724 13:110874805-110874827 CCGCGCCGGCGCCCCGCCCCCGG + Intergenic
1113820233 13:113208565-113208587 CCACGCCGCCGCGCGCTCCCCGG + Intronic
1114473778 14:22980864-22980886 CCGCGCCCCCACCCGGGCCCAGG - Intronic
1115235664 14:31207200-31207222 CCCCGCCGCCGGCAGGGCCCCGG + Exonic
1115235863 14:31207890-31207912 CCGCGTCGCCGTCCCTGCCCCGG + Intergenic
1115320708 14:32076993-32077015 CCGCGCCGCCGCTCCGCCCCCGG + Intronic
1117478301 14:56118753-56118775 CCGCGCCGCTGCCCGGGACCAGG - Intronic
1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG + Intronic
1117978819 14:61322077-61322099 CGGCGCCGCTGCCCCGGCCCCGG - Exonic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1119263609 14:73252066-73252088 CCCCTGCGCCGCCCCAGCCCCGG + Exonic
1119330058 14:73787017-73787039 GCGCGGCCCAGCCCGAGCCCCGG + Intronic
1121050528 14:90816544-90816566 CCCCGCCCCTGCCCCAGCCCTGG - Intergenic
1122065970 14:99174796-99174818 CCGCGCCGCTGCCCAGCCCCGGG - Exonic
1122066037 14:99175086-99175108 CCGCGCCGCCCCCCGCGCCCGGG + Exonic
1122639000 14:103146306-103146328 CAGCTCCACCGGCCGAGCCCCGG - Intergenic
1122657678 14:103273343-103273365 CCGCGCCCCCGCCCGATCCGCGG + Intergenic
1122902160 14:104786425-104786447 GCGTGCCCCCGGCCGAGCCCCGG - Intronic
1122904359 14:104795207-104795229 CCGCTCCGCCGGGCGAGGCCGGG - Intronic
1122904424 14:104795381-104795403 CGGCGCCGCGGCTCGCGCCCCGG + Intronic
1122978537 14:105181031-105181053 CCGCGCTGCCGGCCCCGCCCCGG - Intronic
1122978557 14:105181083-105181105 CCGCGCCCCCGCCGGCGGCCCGG - Intronic
1123036668 14:105474563-105474585 CCGCGGCGCCGCCCGCGCCCCGG - Intronic
1123037987 14:105479073-105479095 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1123054069 14:105561011-105561033 CCCCGCCGCTTCCCGAGCCCGGG - Intergenic
1123078654 14:105681428-105681450 CCCCGCCGCTTCCCGAGCCCGGG - Intergenic
1202872566 14_GL000225v1_random:177696-177718 CAGCGGCGCCTCCCGAGTCCCGG - Intergenic
1124427010 15:29570844-29570866 GCGCGCGGCCGCCGCAGCCCTGG - Intergenic
1126786201 15:52179637-52179659 CCGCGCCACCGCCCGGGAGCAGG - Intronic
1126890284 15:53197594-53197616 CCGCGTCGCCGCCTGTGCCAGGG - Intergenic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1129189128 15:73927398-73927420 CCACGCCGCCGCCCGCGGGCCGG - Exonic
1129933729 15:79432339-79432361 CGCCTCCGCCGCCCGAGTCCAGG - Intergenic
1131827365 15:96332014-96332036 GCGCGCCGGAGCCCGAGACCCGG + Exonic
1131827377 15:96332050-96332072 CCCCGCCGCCGCCCGCAGCCAGG + Exonic
1132560199 16:590055-590077 CCGCCGCGCCGCCCCACCCCCGG - Intronic
1132583067 16:694151-694173 CCGCGCCCCCGGCCCAGCGCGGG - Exonic
1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG + Exonic
1132942410 16:2514582-2514604 CCGCGCCGCCGCCCGCGCACTGG - Intronic
1133156388 16:3879940-3879962 CGGCCCGGCCGCCCGTGCCCGGG - Exonic
1133311307 16:4848133-4848155 CTGCGCCGCCGCCCGGGGACCGG + Intronic
1134134054 16:11668347-11668369 CCGCCCCGCCGTCCCAGCGCGGG + Intergenic
1134588651 16:15434504-15434526 CTCCGCCGCCGCCAGCGCCCGGG - Exonic
1135335803 16:21599912-21599934 CCACGCCCCCGCCCCGGCCCCGG - Intronic
1136111003 16:28063586-28063608 CCGCGCCGCGCCCCCACCCCGGG - Intergenic
1136522422 16:30805676-30805698 CCGGGCCGGCGTCCGGGCCCAGG + Intergenic
1136590352 16:31214670-31214692 CCGCGCTCCCGGCCCAGCCCTGG - Intronic
1137743836 16:50806436-50806458 CCGAGCCGCAGCCAGAACCCAGG + Intergenic
1139446296 16:67000742-67000764 ACGCGCCGGCGCGCGCGCCCGGG + Exonic
1139528095 16:67528776-67528798 CCGCCCCGCCGCCCCTCCCCTGG - Intronic
1139761470 16:69187489-69187511 GCGCGTCGCCGCCCGTGCGCCGG + Exonic
1139954403 16:70686277-70686299 CAGCGCCGCCCCCCGACCCTCGG - Intergenic
1141132185 16:81444467-81444489 CCGCGCCCCCGCGGGTGCCCGGG - Intergenic
1141418922 16:83899200-83899222 CCCCGCGGCCGCCCGGGCCCCGG + Exonic
1141617853 16:85220373-85220395 CTGCGCCGCCGCCCGCTCGCCGG - Intergenic
1141665434 16:85463059-85463081 CTGCGCCGCCCCCCGGGCCGCGG - Intergenic
1141720069 16:85751072-85751094 GCGCGCGGCTGCCCGAGCGCCGG - Exonic
1141972247 16:87492252-87492274 CCGCGCCGCGACCCGGGGCCGGG + Intergenic
1142009308 16:87705788-87705810 CCCCGCCCCCGCCCCCGCCCAGG - Intronic
1142550051 17:732782-732804 CCGAGACGCCCCCCGAGGCCCGG + Intronic
1142670534 17:1485733-1485755 CCGCTCCGCTGCCCGCGCTCCGG + Intronic
1142762310 17:2049881-2049903 CCACGCCGCGCCCCGAGCCGCGG - Intergenic
1142876294 17:2853647-2853669 CGGCCCCGCCTCCCGCGCCCCGG - Intronic
1143155428 17:4833453-4833475 CCGCGCCTCCCCCGGAGACCGGG - Exonic
1143166366 17:4899162-4899184 CCGCGCGGCCCCCCGGGCCAGGG + Intronic
1143519205 17:7436132-7436154 CCACGCCCCCGCCCCCGCCCCGG + Intronic
1143519428 17:7437172-7437194 GGGCGCCGCCGCCCGGGTCCCGG - Exonic
1143719401 17:8799244-8799266 CCGCGGCGCCGCCCCAGACCGGG - Exonic
1143783225 17:9240190-9240212 GTGCGCCGCCGGCCGGGCCCTGG + Exonic
1144185165 17:12789811-12789833 CCCCGCTGCCGCGCTAGCCCGGG - Exonic
1144747643 17:17626447-17626469 CCCAGCCCCCGCCCGATCCCAGG - Intergenic
1144828771 17:18120734-18120756 CCGCGCCACAGCCCGCGCCCAGG + Exonic
1144871864 17:18376868-18376890 CCGGGCCTCAGCCAGAGCCCAGG + Intergenic
1146143448 17:30388926-30388948 CAGAGCCTCCTCCCGAGCCCAGG + Intronic
1147150445 17:38510881-38510903 CCTCGCAGCCGCCCGCGCCCGGG + Exonic
1147179435 17:38674870-38674892 CCTCCCCGCCGCCTGGGCCCGGG - Exonic
1147184387 17:38705593-38705615 CCGGCCCCCCGCCCCAGCCCCGG + Exonic
1147341286 17:39754511-39754533 CCCCGCAGGCGCCCGAGCGCCGG + Intergenic
1147643195 17:42017594-42017616 CCGCGCCGGGGCGGGAGCCCAGG + Exonic
1147970973 17:44219078-44219100 CCCCGCCGGCGCCCCCGCCCCGG + Intronic
1148629066 17:49092606-49092628 CCCCACCCCCGCCCCAGCCCAGG - Intergenic
1148786801 17:50149635-50149657 CCCGGCCGCCCCCCAAGCCCCGG - Exonic
1149994616 17:61400093-61400115 GCGCGCCGCCGCCCGGGCCGGGG + Exonic
1150108564 17:62479021-62479043 CCCCGCGGCCGCCCGGGCCCGGG + Exonic
1150217205 17:63477351-63477373 CCCCGCCCCCGCCCGGGCCCGGG - Intergenic
1150643438 17:66964534-66964556 CGGCGCCGCCCCTCGAGCCTCGG - Intergenic
1150764633 17:67993571-67993593 GCGCGCCGCCGCGCTGGCCCCGG - Intronic
1150802208 17:68291338-68291360 GCGTGCTGCCGCCCGCGCCCCGG + Intronic
1150830264 17:68512527-68512549 GCCCGCCGCCGCCCGTCCCCAGG + Exonic
1151370605 17:73644420-73644442 CCGGGTCGCCGGCCGAGCTCCGG + Intergenic
1151555218 17:74843183-74843205 CCGGGCCGCCCCCCGACGCCGGG - Exonic
1151719219 17:75846122-75846144 CCCCGACGCCACCCAAGCCCTGG + Exonic
1151749427 17:76028198-76028220 CCGGGCCTCAGCCAGAGCCCAGG - Intergenic
1152091069 17:78248237-78248259 CCCCGCTGCCTCCCGAGCTCTGG + Intergenic
1152349692 17:79777925-79777947 CCCCGCCCCCGCCCCCGCCCGGG + Intergenic
1152406575 17:80101472-80101494 CCGCGCAGGCGCCCGAGGCAAGG - Intergenic
1152689742 17:81712526-81712548 CCGCCCCGCGTCCCGGGCCCCGG - Intronic
1152721889 17:81927482-81927504 CCGCGCCGCCCCCACCGCCCGGG + Intronic
1152758847 17:82098088-82098110 CCGCGCCCCGGCCCCAGCGCCGG + Intronic
1153688239 18:7567369-7567391 GCGCGCCGCCGCCCGGGGCTGGG + Exonic
1153794472 18:8609676-8609698 GCCCGCCGCCGCCCGCCCCCCGG - Exonic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1155209231 18:23586565-23586587 TCGCGGCGGCGCCCCAGCCCGGG - Exonic
1156099754 18:33578780-33578802 CCGAGCCGCCGCCCGCTCGCCGG + Intronic
1156171836 18:34494356-34494378 CCCCGCCGCCCCCCGTCCCCGGG - Intronic
1157464200 18:47930529-47930551 CCGGGCCGCCGGCCGGGCCCGGG - Exonic
1157610102 18:48950613-48950635 CCGGGCCCCCGCGCGCGCCCCGG - Exonic
1157849086 18:51030602-51030624 CCTCGCCACCGCCCGAGCCCAGG + Exonic
1159988792 18:74877369-74877391 CCGCGCCGCCTTCCTATCCCAGG + Intronic
1160024787 18:75208787-75208809 GCGCGGCGCGGCGCGAGCCCGGG + Intronic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160791550 19:925885-925907 CAGCGCCGCGGCCCGGGCGCGGG - Intronic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160988077 19:1848665-1848687 CAGCGCCGCCGCCCGACCTTCGG + Intergenic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1161048850 19:2151455-2151477 CCCCGCCGCCGCCCTGGCCTGGG - Exonic
1161179084 19:2867443-2867465 CCGAGCCGGAGCCGGAGCCCTGG + Intronic
1161479156 19:4502027-4502049 CCCAGCCCCCGCCCGAGCTCAGG + Exonic
1161538019 19:4831717-4831739 CCACCCCGCGGCCCGCGCCCTGG + Intergenic
1162021386 19:7869993-7870015 CCACGCCGCCCCCCGACCCCGGG - Exonic
1162410518 19:10502721-10502743 CGCCTCCACCGCCCGAGCCCCGG + Intronic
1162741796 19:12777798-12777820 CCGCTCCACCGCCCCAGCCGGGG - Intronic
1163148639 19:15398681-15398703 CCTCGCCGGCGCCCGGCCCCTGG - Intronic
1163154512 19:15432577-15432599 CCGCCCAGCCCCCCGAGCCCGGG - Intronic
1163158038 19:15449681-15449703 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1163334335 19:16661146-16661168 CCGTCCCGCCGCCCGCGGCCCGG - Exonic
1163453766 19:17394132-17394154 CCGAGCCGGGGCCGGAGCCCGGG - Intergenic
1163473478 19:17511654-17511676 CCCCGCCGCCGCCCTCGCCATGG + Exonic
1163577279 19:18118126-18118148 CGCCGCAGCCGCCCGAGGCCGGG - Intronic
1163663921 19:18594408-18594430 ACGCCCCGCCGCCCGGGCCCGGG + Exonic
1164977016 19:32581115-32581137 CCGCGCCGCTGCCAGGGCGCCGG - Exonic
1165349739 19:35269190-35269212 CCGCGCCCCGGCCCCGGCCCCGG + Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1166762641 19:45234564-45234586 CTGCGCCACCGCGCCAGCCCCGG + Intronic
1166807585 19:45496630-45496652 CCCCGTCGCCGCCAGAGCGCGGG + Intronic
1166838407 19:45681670-45681692 CCGCGCTGCCGCCAGAGGGCGGG - Intronic
1167258005 19:48442688-48442710 CCGCGCCGCGGCCGGCTCCCGGG + Exonic
1167578333 19:50328320-50328342 CGGCGCCGCCGCCCGCGTCCTGG + Exonic
1167643682 19:50695040-50695062 CGCCGCCGCGGCCCCAGCCCCGG + Intronic
1167866981 19:52336648-52336670 CAGCGCCGCAGCCCCAGTCCCGG + Intronic
1167915172 19:52734617-52734639 CCGCGCCGCAGCCCCAGTCCCGG - Intronic
1167921466 19:52786346-52786368 CGGCGCCCCGGCCCCAGCCCCGG - Intronic
1167960787 19:53102991-53103013 CAGCGCCGCCGACCCAGTCCCGG - Intronic
1167999355 19:53432367-53432389 CAGCGCCGCTGCCCCAGTCCCGG + Intronic
1168154533 19:54465365-54465387 GCGGGCCGCCCCCCGAGCCCCGG - Exonic
1168309195 19:55452167-55452189 GGGCGCCGCCGCCCGGTCCCAGG + Intergenic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
924985053 2:263563-263585 CCTCGCCGGCGCCCTAGCCAAGG + Intronic
925730817 2:6918239-6918261 ATGAGCCGCCGCCCGAGCCCCGG + Intronic
926095694 2:10079828-10079850 GCGCGTCCCCGCCCCAGCCCTGG - Intronic
926190038 2:10721578-10721600 CGGGGCCGCCTCCAGAGCCCGGG + Intergenic
926423074 2:12717474-12717496 CCGCGCGGCGGGCCGAGCCCAGG + Exonic
927881505 2:26692845-26692867 CCGGGCCGCCGCCGGCCCCCCGG - Exonic
929188635 2:39120551-39120573 CCGCGCAGCCGGGCTAGCCCTGG + Intronic
929201654 2:39243622-39243644 CCCCGCCGCCGCCCACTCCCTGG + Intergenic
930011420 2:46941034-46941056 CCCCGCCGCCGCCCCCGCCGCGG - Intronic
930011524 2:46941406-46941428 CCCCGCTGCCGCCCGGGCCCCGG + Exonic
931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG + Intronic
932773553 2:74514488-74514510 CGGCGCCGCTGCCCAAGTCCCGG - Exonic
933666878 2:84971325-84971347 CCGCCCCCGCGGCCGAGCCCGGG + Exonic
934079241 2:88452855-88452877 CCGCCCCTCTGCCCGGGCCCGGG + Intergenic
935046638 2:99489526-99489548 CCGCGCCGCCGCCAGCCCCATGG - Intronic
935971625 2:108534736-108534758 CCACGCCGCCACCCGAGCGCTGG - Intronic
937951076 2:127388186-127388208 CCCCGCCCCCGCCCCTGCCCCGG + Intronic
938073095 2:128318634-128318656 CTCCGCCGCCGCCCGCGCTCCGG + Intergenic
938460512 2:131493233-131493255 CCGCCGGGCCGCCCGAGTCCTGG - Intergenic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
940646785 2:156400308-156400330 TCGCGGCGCGGCCCGAGCGCTGG + Intergenic
941808585 2:169734059-169734081 CAGCGCCGCGTCCCGAGCCCCGG + Exonic
942151037 2:173076088-173076110 CCGAGGCTCCGCCGGAGCCCGGG + Intronic
942277945 2:174336301-174336323 CCGCCAGGCCGCCCGAGCCACGG - Exonic
942453599 2:176123189-176123211 CCGGGCCGCGGTCCCAGCCCTGG + Exonic
943060471 2:183037860-183037882 CGGCGTCGCCGCCCGAGGCCCGG - Intronic
944154116 2:196593164-196593186 CCGCGCCGCCACCCACCCCCGGG + Intronic
944221767 2:197310559-197310581 CGGCGCCGCCGCCCGCTACCTGG + Exonic
945043705 2:205763789-205763811 CCCCGCGGCCGCCCGTGGCCTGG - Exonic
945241554 2:207681459-207681481 CCCCGCCGCCGCCCTCGCCGCGG + Intergenic
945245253 2:207711709-207711731 CCGCCCCGCGGCCCGGCCCCGGG - Intronic
946242978 2:218367995-218368017 CCGCGTCCCAGCCCGACCCCTGG - Exonic
946404076 2:219483587-219483609 CAGCGCCGGAGCCCCAGCCCGGG + Exonic
946856760 2:223957630-223957652 GCCCGCCGCCGCCCGTGCGCCGG + Exonic
947119169 2:226798871-226798893 CCACGCCGCCCCCCGCGCCGGGG + Exonic
947748643 2:232522040-232522062 GCGCGGCGCCGCCCGGGGCCTGG + Exonic
948046868 2:234951958-234951980 CCCCGCCCCCGCCCCCGCCCAGG + Intronic
948046964 2:234952211-234952233 CCGCGCCCCCGCCGGCCCCCAGG - Intronic
948806636 2:240455997-240456019 CCAGGCCGGCGCCCGAGCTCTGG + Intronic
1168777802 20:462417-462439 CCGGGCCCCCACCCGAGCCCCGG + Exonic
1168795904 20:610077-610099 GCGCGGCGCGGCCCGGGCCCCGG - Exonic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1170890176 20:20369233-20369255 GCCCGCCGCCGCCCGCGCGCCGG + Exonic
1171122128 20:22577135-22577157 GCCCGCCGCCCTCCGAGCCCCGG - Intergenic
1171122386 20:22578382-22578404 CCGCCCGGGCGTCCGAGCCCTGG + Intergenic
1171823213 20:29874264-29874286 CCGCGCCCCAGCCGAAGCCCAGG + Intergenic
1171896882 20:30816048-30816070 CCGCGCCCCAGCCGAAGCCCAGG - Intergenic
1172118369 20:32584336-32584358 CCGCGCCGCTGCCCGGGCCGTGG - Intronic
1172446754 20:34997246-34997268 CAGCTCCTCCGCCCGAGCCTGGG - Exonic
1172944093 20:38674558-38674580 CCACCCCGCCCCCAGAGCCCCGG + Intergenic
1174246720 20:49187785-49187807 CCCCGCCTGCGCCCCAGCCCCGG + Intronic
1175429312 20:58891107-58891129 CCGGGCTGCTGCCCGAGCCCGGG + Intronic
1175846953 20:62064626-62064648 CCGTCCCGCCGCCCGCCCCCGGG - Exonic
1175961085 20:62636672-62636694 ACGCGCCGCCGACTCAGCCCTGG + Intergenic
1176068978 20:63216271-63216293 CCGCCCCGCCGCACGAGACTGGG - Intergenic
1176156943 20:63626811-63626833 CCGCGCGGCCGCCCCTCCCCCGG + Intronic
1176207215 20:63895493-63895515 CCGCGCCCCCGCCCCGGCCCAGG - Intronic
1176214477 20:63941718-63941740 CCGCCCCGCTGCCCAAGCCTGGG + Intronic
1176547601 21:8208419-8208441 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176566552 21:8391466-8391488 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176574428 21:8435653-8435675 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176611040 21:8986945-8986967 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1178513833 21:33229902-33229924 CCGCGCCGCCGCCGGCGCGGGGG - Intronic
1178948414 21:36966719-36966741 CCGCGCCGCCCCCCCGGGCCAGG + Intronic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179375500 21:40846898-40846920 CCACGCTGCGGCCGGAGCCCAGG + Exonic
1180101600 21:45590344-45590366 GCGCGCGGCCGCCCGCTCCCAGG + Intergenic
1180180846 21:46118117-46118139 CGGCGGGGCCGCCCAAGCCCTGG - Intronic
1180285533 22:10741780-10741802 CAGCGGCGCCTCCCGAGTCCCGG + Intergenic
1180649981 22:17369592-17369614 CCGCGCCGCCGCCCCCCGCCCGG + Exonic
1180801495 22:18634100-18634122 CCGGGAAGACGCCCGAGCCCCGG + Intergenic
1181057761 22:20268030-20268052 CCCCGCCGCCGGCCGGGCTCGGG + Intronic
1181283359 22:21735617-21735639 CCGCTCCGCGGTCCGCGCCCCGG + Exonic
1181299117 22:21867165-21867187 CCGGGGCCGCGCCCGAGCCCTGG + Intronic
1181514361 22:23402664-23402686 CCGCGCCCGCGCCGGCGCCCAGG - Intergenic
1181567980 22:23751233-23751255 GCGCGAAGCCGCCCGGGCCCCGG + Intergenic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1182576475 22:31276574-31276596 CCCCGCCGCCGCCCTCGCCGCGG + Intronic
1182586323 22:31346097-31346119 CCGCTCCGGCGCCCCCGCCCCGG - Exonic
1183411793 22:37659178-37659200 CCGCGCCGTCCCCCGCGCTCGGG - Exonic
1183441301 22:37824649-37824671 CCGCGCCACGTCCCGCGCCCGGG - Intronic
1183476496 22:38038790-38038812 CCCCGCCGGCGCCCGCACCCCGG + Intronic
1183622484 22:38982552-38982574 CCCCGCCCCTGCCCCAGCCCTGG + Intronic
1183720187 22:39557900-39557922 GCCCGCCGCCCCCCGCGCCCCGG + Intergenic
1183912948 22:41092442-41092464 CCGCGCCGCCGCCGCCGCACCGG - Exonic
1184046757 22:41976872-41976894 CCGCGCCGCCGCGCCCTCCCCGG - Exonic
1184164735 22:42720667-42720689 CTGGGCCGCCGCCCTAGCCCGGG - Intronic
1184523091 22:45007408-45007430 CCGCGCTCCCACCCCAGCCCGGG - Intronic
1185321291 22:50201251-50201273 CCGCGCCGCGGCCCGTGCCCGGG + Exonic
1185409521 22:50674617-50674639 CCGCGCCGGGGCCCGGGCCGGGG - Intergenic
1185409651 22:50674926-50674948 GGGCGCCGGCACCCGAGCCCCGG + Intergenic
1203252474 22_KI270733v1_random:124704-124726 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203260531 22_KI270733v1_random:169790-169812 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
949970327 3:9397933-9397955 GTGCGCCGCAGCCCGGGCCCAGG + Exonic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
952287269 3:31981143-31981165 CCCCGCCGCCGTCTGTGCCCTGG + Exonic
952644651 3:35640123-35640145 CCGAGCCGCCGCCGCAGCCCTGG + Intronic
952970927 3:38649697-38649719 CCGCGCCGCCTGCCCAGCCCGGG - Intergenic
953167365 3:40477262-40477284 CCGCGCCGCCGCCAGAGCCTGGG + Exonic
953657082 3:44862275-44862297 CCGCAGCGCCGCCCGCGGCCCGG - Intronic
953883071 3:46701455-46701477 CCGCGCCGCTTGCGGAGCCCAGG - Exonic
954138978 3:48595330-48595352 CCGCTCCGCCCCCCGAGATCAGG - Intergenic
954367814 3:50155515-50155537 CCGTGCCGCCGCCGCCGCCCGGG + Exonic
955818797 3:62874855-62874877 CGGCGCCGGCGCCGGAGCCGGGG - Exonic
958926847 3:100167808-100167830 CAGCTCGGCCGTCCGAGCCCTGG + Exonic
959530739 3:107431552-107431574 CCGCGCTTCCGCCCGAGCCCCGG - Intergenic
960914367 3:122681193-122681215 CCCCGCCCCCGCCCCCGCCCCGG - Intronic
961081521 3:124032922-124032944 CGGGGCCGCCGGGCGAGCCCGGG - Intergenic
961144770 3:124584723-124584745 CAGCGCCGCCGCCCGAGAGCCGG - Intronic
961182386 3:124887057-124887079 CCGCGCTCCGGCCCCAGCCCCGG - Exonic
961551555 3:127672866-127672888 CCGCGGCCCCGCCCCTGCCCCGG - Intergenic
961858248 3:129893663-129893685 CGCCGCCGCCGCCTCAGCCCCGG + Intergenic
961888594 3:130112085-130112107 CCGCCCCGCCTCCCGGACCCTGG - Intronic
963038300 3:141051146-141051168 CCGCGCCGCCGCCTTGGCACAGG + Intergenic
963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG + Intronic
963091586 3:141487532-141487554 CCGCGCCCCCGGCCGCGCCCCGG - Intronic
964474864 3:157089153-157089175 CCTCGCCGCCGCCTGACCGCTGG - Intergenic
965882039 3:173397758-173397780 CCGCGCCGCCGCCTGATCCTCGG - Intronic
966594202 3:181711784-181711806 CCGCGCCGCCGGCCGCGCGGGGG - Intergenic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
966794130 3:183697964-183697986 CCGCGCTGCAGCCGGAGACCCGG + Exonic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
967272022 3:187740056-187740078 CAGCGCCGTCGCCCCCGCCCGGG - Intronic
967867749 3:194204195-194204217 CCGAGACGCGGCCCGGGCCCGGG + Intergenic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968213341 3:196867798-196867820 CCGCCCCGCCTCCCGACCCGGGG - Intergenic
968433908 4:575507-575529 CCGAGCCGGGGGCCGAGCCCGGG + Intergenic
968593736 4:1472213-1472235 CCGCGGGGCAGCCGGAGCCCGGG + Intergenic
968755126 4:2411825-2411847 CCCCGCTGCCACCCGAGCCCTGG + Intronic
968803173 4:2756256-2756278 CCTCCCAGCCGCCCGACCCCGGG + Exonic
968907978 4:3463325-3463347 TCGCCCCGGCGCCCCAGCCCAGG - Exonic
968907981 4:3463339-3463361 CCGCGCCGCCGCGCTCGCCCCGG - Exonic
968965362 4:3766614-3766636 CAGCGCCGCCGCCAGCGCCGGGG - Exonic
969285704 4:6200668-6200690 CCCCGCCCCCGCCCCCGCCCCGG + Intergenic
969416977 4:7067475-7067497 CCGTGCCGCAGCTCGAGGCCGGG - Intronic
971257925 4:25030881-25030903 GCGCCCCCCCACCCGAGCCCGGG + Intergenic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
972418699 4:38867565-38867587 GCGCGCCGCCTCTCCAGCCCAGG - Intergenic
972675690 4:41257497-41257519 CCGCGCCCGCACCCGAGCCTGGG - Intronic
975485762 4:74933089-74933111 CATCCCAGCCGCCCGAGCCCGGG - Intronic
975701999 4:77075737-77075759 GGCCGCCGCCGCTCGAGCCCGGG + Exonic
975778959 4:77819604-77819626 CGCCGCCGCCGCCCGGACCCCGG - Intronic
978384473 4:108166945-108166967 CCGCACCGCCCCCGCAGCCCGGG + Intronic
979122929 4:116926285-116926307 CCGCGCCGCCGCCCCTCTCCGGG + Intergenic
980355628 4:131729924-131729946 CAGCACCGCCGCCCCAGTCCCGG + Intergenic
981093342 4:140755850-140755872 CTGCGGCGCCGCCCGCGGCCTGG - Intronic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
983919811 4:173333827-173333849 CCGCGCCCCCGCCCGCGCCCCGG + Intronic
984811390 4:183798344-183798366 CCGAGCCGCCCGCCGAGCCGCGG - Intergenic
984888645 4:184473247-184473269 CCCCGCCGCGGCCCGCGCCCCGG + Intronic
984928321 4:184825858-184825880 CCGCGGCGGTGCCCGGGCCCCGG - Intronic
985129010 4:186723556-186723578 CAGCGCCGGAGCCCGAGCCGGGG + Intronic
986330610 5:6713907-6713929 CCCCGCCGCGCCCCGAGGCCCGG - Intergenic
986608427 5:9545497-9545519 CCGCGCCGCTGGCCGGGACCCGG - Intronic
986733281 5:10650138-10650160 CCCCGCCCCGGCCCCAGCCCCGG - Exonic
988796291 5:34656293-34656315 CCGCCCCGCCGGCCTAGCCCGGG + Intronic
989147051 5:38259007-38259029 CCTCGCCCTCCCCCGAGCCCGGG + Intronic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
990308799 5:54518558-54518580 CCGAGCCGCCGCGGGAACCCAGG - Exonic
993116161 5:83722253-83722275 CCGCGCCACAGCCCGAGCGGCGG - Intergenic
994083224 5:95731215-95731237 CCCCGCATCCGCCCGACCCCCGG + Exonic
996065163 5:119071390-119071412 CCGCGACTCATCCCGAGCCCCGG - Intronic
996404292 5:123090636-123090658 CGGCGCCGGCGCCGGCGCCCCGG - Intronic
997479740 5:134176467-134176489 CCCCGCCGCCACCCCCGCCCTGG + Intronic
997485268 5:134225902-134225924 CCGCGCCGCCGCCCGCACACGGG + Exonic
998152302 5:139764455-139764477 CCACGGCGCCGCCAGACCCCCGG - Intergenic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
999767919 5:154755243-154755265 GCGCGCCGCTGGCCGGGCCCTGG - Intronic
1000622963 5:163505809-163505831 CTGCAAAGCCGCCCGAGCCCCGG - Intronic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1001220521 5:169896170-169896192 CCTCCCCGCCCCCCGACCCCAGG - Intronic
1002089996 5:176798705-176798727 CCGCGCGGCTCCCCGAGTCCTGG - Intergenic
1002169528 5:177367364-177367386 CAGCGCCCCCACCCCAGCCCCGG + Intronic
1002541310 5:179907994-179908016 CCGCGCCGCCCCCTCAGCCCCGG + Intergenic
1002888035 6:1312854-1312876 TGGCGCCGCCGCCCGCGGCCGGG - Exonic
1003291278 6:4780408-4780430 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1005470253 6:26156316-26156338 CAGCGCCGCGGCTCGAGTCCCGG + Intergenic
1005875474 6:30007276-30007298 CAGCCCCGCCCACCGAGCCCTGG - Intergenic
1005968270 6:30742530-30742552 CCGGGCTGCCGCCCGCGTCCCGG - Exonic
1006932761 6:37697608-37697630 CCGCGCCGCAGCCCCGGCCTGGG - Exonic
1007347130 6:41239694-41239716 CTGCGCCCCCGCGGGAGCCCGGG - Intergenic
1007390259 6:41546545-41546567 CCCCGCCCCCGGCCCAGCCCTGG - Exonic
1007785189 6:44275837-44275859 CTGCGCTGCTGGCCGAGCCCGGG - Exonic
1012401413 6:98845242-98845264 CCGCCCCGCCCCGCGGGCCCCGG + Intergenic
1015149254 6:130019941-130019963 CCGCGCCCGCGCCCGCACCCGGG - Intronic
1016330537 6:142947576-142947598 CCGCGCCGCCGCCCTGCCCGGGG + Intergenic
1016340922 6:143060817-143060839 CCGCGCCCGCGCCCGCGCCCGGG + Intronic
1017163779 6:151390283-151390305 CCGCGCCCCCGGCCCCGCCCCGG - Intronic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1017324582 6:153130967-153130989 CCGCGCAGCCGCCCCCGCCGGGG + Intronic
1017738211 6:157381914-157381936 CCCGGCCGCCCCCCGAGCCGCGG - Exonic
1017877495 6:158536711-158536733 CCGCGCAGCCTCCCGGGTCCCGG - Exonic
1018020898 6:159761835-159761857 CCGCCCCGCGCCCCGCGCCCCGG + Exonic
1018670103 6:166169888-166169910 CCGCGACGCCGTCCGAGCGCAGG - Intergenic
1019103133 6:169648289-169648311 CCGTGCACACGCCCGAGCCCTGG + Intronic
1019381652 7:727284-727306 CTGCGCCGCCGCCCTGGCGCAGG + Exonic
1019461399 7:1160719-1160741 CCGCGCTGCCCCCCGCCCCCTGG + Intronic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019662448 7:2232497-2232519 GCGCGCCGGCACCCTAGCCCGGG + Intronic
1019743707 7:2688240-2688262 CCGCGCCGGGCACCGAGCCCCGG - Intronic
1020274331 7:6615600-6615622 CCGCGCCCCCGCCCCCGGCCCGG + Exonic
1020275527 7:6622371-6622393 CCGCGCTGCCTGCCGGGCCCGGG - Exonic
1021958804 7:25852590-25852612 CCGCGCCCCCGCCCCGGCTCGGG + Intergenic
1022096269 7:27143353-27143375 GCGCGGCGCCCGCCGAGCCCAGG - Exonic
1022989629 7:35694934-35694956 CCGCGCCTCCTCGCGAGACCCGG - Exonic
1023637587 7:42228070-42228092 CCGCGCCGCCGCCGCGGCCTGGG - Intronic
1023937261 7:44748854-44748876 TCGCGCCGCCGCCCGCTCCGAGG - Intronic
1024043801 7:45574415-45574437 CCGCCCCGCGCCCCGCGCCCCGG + Intronic
1024043824 7:45574466-45574488 CGGCGCCGCCGCCCGCGCCCCGG + Intronic
1024216704 7:47254560-47254582 CCGCCCCGCCCGGCGAGCCCGGG + Intergenic
1029367825 7:100127655-100127677 CAGCAGCGCCTCCCGAGCCCAGG - Exonic
1030093382 7:105876857-105876879 CAGCGGCGCCGCCCAAGCCTGGG + Intronic
1030176382 7:106660013-106660035 CCGCGCCGCGGCCCGGGACAGGG + Exonic
1031447643 7:121873692-121873714 CCGCGCGGCCGCCCGCTCCGTGG - Intronic
1032194428 7:129780958-129780980 CCGCGTCCGCGCCCCAGCCCCGG - Intergenic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032693833 7:134316556-134316578 CCCCGCCGCCCACGGAGCCCGGG - Intronic
1033033165 7:137846601-137846623 CCGCGCCGCCCTCGGCGCCCAGG + Exonic
1033365950 7:140672912-140672934 CCCCGCCTGCGCCCGCGCCCTGG + Intronic
1033595271 7:142854758-142854780 CCGAGCCCGAGCCCGAGCCCAGG + Intergenic
1034147033 7:148883514-148883536 GAGCGCCGCGGCCCCAGCCCGGG + Intronic
1034192670 7:149223946-149223968 CCGGGCGGCCCCCCGAGCCGAGG + Exonic
1034433245 7:151051263-151051285 CCGCGCCGCCGCGCGCTTCCTGG + Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1035751845 8:2002045-2002067 CTGCGCCGCCGCCTGCGCGCCGG + Exonic
1036195271 8:6708499-6708521 CCGCGCCGCCGCCCGGGGCCGGG - Exonic
1036454252 8:8893565-8893587 CCGCGCTCCCGCCCGAGCCCGGG - Exonic
1036871413 8:12436920-12436942 CGGCCCCGCCTCCCGGGCCCTGG - Intergenic
1036910381 8:12754072-12754094 CCGCGCGGGCGCCCGGCCCCGGG - Intronic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1039936620 8:42051734-42051756 CGGCGCCCCAGCCCGAGGCCTGG + Intronic
1039996790 8:42541401-42541423 CCGCGCCGCGACCCCCGCCCGGG - Intronic
1039996890 8:42541769-42541791 CCGCGCCGCCCGCCCCGCCCCGG + Intronic
1041244766 8:55879858-55879880 CCGCGCTGCCGCTCGCTCCCCGG + Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042216351 8:66432519-66432541 GGCCGCTGCCGCCCGAGCCCGGG + Exonic
1042246425 8:66712867-66712889 CCGGGCCGCCGTCGGAGTCCCGG - Intronic
1043053357 8:75407973-75407995 CTCCGCCGCCGCCCGGGGCCCGG + Intronic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1045047595 8:98294150-98294172 CCGAGCCGGAGCCCGAGCGCCGG - Exonic
1045304816 8:100950637-100950659 CCGCGCCCCCGCCCAAGCCGTGG + Intronic
1049108654 8:140629343-140629365 CAGCGCAGGCGCCCGTGCCCGGG + Intronic
1049109698 8:140635379-140635401 CCCCGCGGCCCCCCGATCCCCGG + Intronic
1049406092 8:142452433-142452455 CTGCGCCCCCTCCCTAGCCCGGG - Intronic
1049419571 8:142510823-142510845 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1049552535 8:143267219-143267241 CAGCGCCGCTCCCCGCGCCCGGG + Intronic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049616596 8:143578277-143578299 CCGCGCCGCCGCGCGCGCCTCGG + Exonic
1049638974 8:143705745-143705767 GCGCGGCGCCGCTCTAGCCCTGG + Intronic
1049665608 8:143841290-143841312 CCCCGCCCCCGCCCGTTCCCAGG + Intergenic
1049775302 8:144401182-144401204 CCGCGCTCCCGCCCCCGCCCAGG - Intronic
1050091300 9:2017678-2017700 CCGCGCCACAGCCCGCGGCCCGG - Intronic
1056578018 9:87870658-87870680 CTCAGCCGCCGCCCTAGCCCTGG - Intergenic
1056732494 9:89178176-89178198 CCGCGCGCCCGCCCGCTCCCGGG + Exonic
1057314145 9:93958299-93958321 CCTCCCCGTCGCCCGACCCCAGG + Intergenic
1057623267 9:96655224-96655246 CGGCGCCGCCGCCCTGGTCCCGG - Exonic
1057933989 9:99221639-99221661 CGCCGCGGCCGCCCCAGCCCAGG + Exonic
1058053436 9:100427670-100427692 CCGAGCAGCTCCCCGAGCCCGGG - Intronic
1059021312 9:110579568-110579590 CCGAGCCGCCGCCTGCGCTCCGG - Exonic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1060821754 9:126665304-126665326 CGCCCCCGCCGCCCCAGCCCTGG - Intronic
1061248443 9:129413424-129413446 CCGGGGGGCCGCCCGAGCTCCGG + Intergenic
1061264499 9:129497351-129497373 CCCCGCCCCCGCCCGGGCCTAGG - Intergenic
1061293665 9:129666043-129666065 CCGCGCCTCGGCCCTGGCCCCGG - Exonic
1061293713 9:129666168-129666190 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1061860614 9:133466729-133466751 CCCCGCCCCCACCCCAGCCCAGG + Intronic
1062022605 9:134326535-134326557 GCTCCCCGCCGCCCGGGCCCGGG + Intronic
1062547420 9:137069986-137070008 CAGCGCCGCCGCCCGCAGCCCGG - Exonic
1062582173 9:137233558-137233580 CCCCGCGGGCGCCAGAGCCCCGG + Intronic
1203774124 EBV:63300-63322 CCGCGTCGACGCCCGAGAACGGG - Intergenic
1203731888 Un_GL000216v2:98846-98868 CAGCGACGCCTCCCGAGTCCCGG + Intergenic
1203468879 Un_GL000220v1:107855-107877 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203476700 Un_GL000220v1:151827-151849 ACGCGCCGCAGGCCGACCCCCGG - Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185641583 X:1591846-1591868 AGGCGCCGCCTCCCAAGCCCCGG - Intronic
1186426190 X:9465524-9465546 CCGAGCCGCCGGCCGGACCCTGG - Intronic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1186788610 X:12975531-12975553 CCGCGCAGCCGTCCGAGGCTGGG - Exonic
1187225851 X:17375147-17375169 CCGCGCGGCCTCCTGCGCCCGGG + Intergenic
1189534512 X:41923174-41923196 CGGCCCCGCCGCCCGCGCCGGGG - Intronic
1192817980 X:74614284-74614306 CAGCGCCGCCTCCGGACCCCAGG - Intronic
1195923230 X:110002808-110002830 CCGCGCCTCCCGCCCAGCCCCGG - Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1199445099 X:147912031-147912053 CCGCGCTGCCGCACGCCCCCTGG - Exonic
1199500379 X:148500704-148500726 CCGCGCCGCTGCCTCTGCCCCGG + Exonic
1200100730 X:153688233-153688255 AGCCGCCGCCGCCCGAGCCGCGG + Exonic
1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG + Exonic
1200128466 X:153829205-153829227 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG + Intronic
1200177173 X:154125440-154125462 CCGCGCCCCAGCCTCAGCCCCGG + Intergenic