ID: 972397775

View in Genome Browser
Species Human (GRCh38)
Location 4:38672455-38672477
Sequence CTGGCTGCACAGAGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 3, 3: 57, 4: 441}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972397768_972397775 -6 Left 972397768 4:38672438-38672460 CCCCAGGGAGCAATCAGCTGGCT 0: 1
1: 0
2: 2
3: 15
4: 150
Right 972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG 0: 1
1: 1
2: 3
3: 57
4: 441
972397769_972397775 -7 Left 972397769 4:38672439-38672461 CCCAGGGAGCAATCAGCTGGCTG 0: 1
1: 0
2: 0
3: 17
4: 155
Right 972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG 0: 1
1: 1
2: 3
3: 57
4: 441
972397770_972397775 -8 Left 972397770 4:38672440-38672462 CCAGGGAGCAATCAGCTGGCTGC 0: 1
1: 0
2: 1
3: 20
4: 174
Right 972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG 0: 1
1: 1
2: 3
3: 57
4: 441
972397765_972397775 3 Left 972397765 4:38672429-38672451 CCTTGGATCCCCCAGGGAGCAAT 0: 1
1: 0
2: 0
3: 16
4: 153
Right 972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG 0: 1
1: 1
2: 3
3: 57
4: 441
972397767_972397775 -5 Left 972397767 4:38672437-38672459 CCCCCAGGGAGCAATCAGCTGGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG 0: 1
1: 1
2: 3
3: 57
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972397775 Original CRISPR CTGGCTGCACAGAGTGGGGA GGG Intronic
900202885 1:1419257-1419279 CTGGCTGCAGAGCGAGGGCATGG - Exonic
900548589 1:3242167-3242189 CTGGCAGGACAGGGCGGGGAGGG + Intronic
900610674 1:3543332-3543354 CGGGCTGCTCAGAGCAGGGAAGG - Intronic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
900903311 1:5532199-5532221 CTGTCTGCACAGTGTTGGGGAGG + Intergenic
901269343 1:7939511-7939533 AGGGCTTAACAGAGTGGGGACGG - Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902481736 1:16715665-16715687 CTGGCTGCAGGGCGTGGGGGCGG - Intergenic
902917358 1:19646648-19646670 CTGGGTGCAGAGGGTGTGGAGGG - Intronic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
903972962 1:27131039-27131061 CTGGCTGCTGAGACTGGGCAGGG + Intronic
904384255 1:30131321-30131343 CTCCTTGTACAGAGTGGGGAGGG - Intergenic
904604254 1:31690331-31690353 CTGGCTGCCCAGATCGGGGTGGG - Intronic
905340316 1:37273536-37273558 CTGGATGCTGAGAGTGGGCAAGG - Intergenic
905933500 1:41806305-41806327 CTGACTACACAGCGTGGGCATGG + Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906565589 1:46798963-46798985 CTGGCTGCAGGGAGTGGCTAGGG + Intronic
907057383 1:51382875-51382897 CTGGCTTCACAGAATGAGTATGG - Intronic
907527246 1:55061036-55061058 CTGGCTGCATAGGGAGGGGCTGG + Intronic
907977321 1:59444589-59444611 CTGGCTGCACAGCATGAGGTGGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908605314 1:65792273-65792295 CTGGCTGCACAAAGAGGGACTGG - Intergenic
910333714 1:86105054-86105076 GTGGCTGCACAGGGTGGGAGAGG + Intronic
911020332 1:93380153-93380175 ATGGCTACAAAGACTGGGGAGGG + Intergenic
911900930 1:103502933-103502955 CTGGCTGAAGGGAGTTGGGAGGG - Intergenic
913052449 1:115129483-115129505 GTGTCTGCACAGAGTGGGGTGGG + Intergenic
915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG + Intronic
917477597 1:175382405-175382427 CTGGCTGCAAAGAGCAGGGTAGG - Intronic
917638015 1:176955851-176955873 GTGGCTACAGAGAGTAGGGAAGG + Intronic
917704004 1:177613117-177613139 CTGGCTGCAGTGAGAGGGGCTGG - Intergenic
917788924 1:178487176-178487198 CTGTCTGCACTGGGTGGGCAAGG - Intergenic
919180103 1:194069645-194069667 TTGGCAGCACTGAGTGGGGAGGG - Intergenic
919818269 1:201455771-201455793 CTGCCTGCACAGTCTGGTGAGGG - Intergenic
919845711 1:201640870-201640892 CTGTGTGCACAGAGCTGGGATGG + Intronic
920347725 1:205317450-205317472 CAGGCTGGGCAGAGTGGGGGTGG + Intronic
922452269 1:225746794-225746816 CTGGCTTCTCACACTGGGGAGGG + Intergenic
922741771 1:228018181-228018203 TTGGCTGCAGTGAGTGGGGGAGG - Intronic
922754742 1:228089397-228089419 CTGACTGACCAGAGTGGGGTGGG + Intronic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
923926946 1:238640064-238640086 CTGCTTTCAGAGAGTGGGGAAGG - Intergenic
1063238369 10:4142523-4142545 CAGACTGCACAGGGTGGGTAAGG - Intergenic
1063568892 10:7196397-7196419 CTGATTGCACAGCGTGGGCATGG - Intronic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1064887972 10:20134377-20134399 CTGGATGGACTGAGTGGTGAAGG - Intronic
1065307835 10:24385097-24385119 CAGGCAGCACAGAAAGGGGAGGG + Intronic
1065817612 10:29496360-29496382 CTGGTATCACAGGGTGGGGAGGG + Intronic
1065955251 10:30688035-30688057 CTGGTATCACAGGGTGGGGAGGG - Intergenic
1066678413 10:37912899-37912921 CGGGCTGCACAGAGAAGGAAAGG - Intergenic
1067098510 10:43317990-43318012 AAGGCTGCAGAGAGTTGGGATGG + Intergenic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1068828962 10:61471174-61471196 ATTGCTACAAAGAGTGGGGAAGG - Intergenic
1069778321 10:70939540-70939562 CTAGCTCCAGAGGGTGGGGAGGG + Intergenic
1069795784 10:71050899-71050921 CTAGCAGCACAGAGCTGGGAAGG - Intergenic
1070566209 10:77605553-77605575 CTGGCTGCACTGTGTAGGGAGGG - Intronic
1070742059 10:78909728-78909750 CTGGGACCACAGAGTGGAGAAGG + Intergenic
1070824976 10:79385715-79385737 CTGGGTCCATAGCGTGGGGAGGG + Exonic
1070825923 10:79390705-79390727 CTTGCTGCAGGGAGTGGGGGAGG - Intronic
1071368727 10:84928345-84928367 CTGGCTGTCCAGAGTGTGGGAGG + Intergenic
1071487766 10:86114128-86114150 CTCTCTGCACAGGGTGGGGCGGG + Intronic
1071954692 10:90744710-90744732 ATGGCTACAGAGAGTTGGGATGG + Intronic
1072525578 10:96268615-96268637 CTGGATGAACCCAGTGGGGATGG - Intronic
1073357802 10:102870780-102870802 CTGGATGCGCAGGGTTGGGAAGG - Intronic
1075979577 10:126724914-126724936 CCAGCTGCTCAGGGTGGGGAGGG + Intergenic
1076353267 10:129833020-129833042 TTGGCTGCACTCAGTGGGGCAGG + Intergenic
1076405602 10:130210544-130210566 CTGGCTGCAGGAAGTGGGAAAGG - Intergenic
1076649266 10:131976621-131976643 CTGGTTGCAGAGAGTGTGGTTGG - Intronic
1076898822 10:133327105-133327127 CTGGCTGCCCAGGGCGGGGGTGG - Intronic
1077141988 11:1028819-1028841 CGGGCTGCAGTGGGTGGGGAGGG - Intronic
1077414777 11:2420011-2420033 CTGTCTGGGCAGAGTGGTGAAGG - Intronic
1077442434 11:2574933-2574955 CTGCCTGCAGTGAGTGTGGATGG + Intronic
1077501638 11:2912171-2912193 CTGGCTGCCCAGAGTGGTGGTGG + Intronic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1078860889 11:15245178-15245200 CTGGTTGCACAGGGGAGGGAGGG + Intronic
1083365785 11:62140795-62140817 CTGGCTGGGCAGGGTGAGGAAGG - Exonic
1083731734 11:64655970-64655992 CTGGCTGGACAGAGAGAGCAGGG + Intronic
1084365175 11:68693021-68693043 CAGGCTGCACACCGTGGGGCTGG - Intergenic
1085112433 11:73899753-73899775 TTGGCAGAACAGAGTGGGGCTGG + Intronic
1085279402 11:75320251-75320273 CTGCCTGCCCAAGGTGGGGAGGG + Intronic
1085530809 11:77190913-77190935 CTGGCAGCCCGGAGTGGGGCCGG - Intronic
1085699122 11:78730505-78730527 CCAGATGGACAGAGTGGGGAAGG + Intronic
1086037869 11:82438719-82438741 GAGGCTGCACAAGGTGGGGAGGG + Intergenic
1086478795 11:87210651-87210673 CTGGCTTCACAGAGTGAGTTAGG - Intronic
1086534180 11:87824091-87824113 CTGTCTGCACAGAGATGGGGAGG - Intergenic
1087027064 11:93660657-93660679 CTGGCTGCACAGTGGGGAAAAGG - Intergenic
1088357597 11:108960076-108960098 ATGGCTGACCACAGTGGGGACGG + Intergenic
1088431592 11:109765096-109765118 CTGGCTGATCAGAGTGGAAATGG - Intergenic
1089358210 11:117869531-117869553 CCGGCTGCACAGGGTGGAGCGGG + Intronic
1090398761 11:126435340-126435362 CTGGCTGGCCAGGGTGGGGTGGG + Intronic
1090488455 11:127136243-127136265 CTGGCTCCTCAAAGTGGGAAGGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090828287 11:130403240-130403262 CTGGGTGCACAGAGTGGTCGTGG + Intergenic
1091907217 12:4198678-4198700 GTTGCTGAACAGAGAGGGGAGGG - Intergenic
1092029068 12:5268821-5268843 TTGGCTGCAGAGAGAAGGGAAGG + Intergenic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1092776018 12:11945870-11945892 CTGTCTGCTCAGAGTGCAGAAGG + Intergenic
1094476338 12:30843520-30843542 CAGGCTGGACATAGTGGAGAGGG + Intergenic
1094765454 12:33589243-33589265 CTGGCTTCACTTAGTGGGGTTGG + Intergenic
1095253111 12:40001236-40001258 CTGGCAGCACATACTGGAGAGGG + Intronic
1097195195 12:57239150-57239172 CTGGCTGCACAGAGGGTCAAAGG + Intronic
1098431299 12:70422881-70422903 CTGGGAGCACAGAGTGGCGACGG + Intronic
1102875262 12:116444093-116444115 CTGGCGGGGCAGAGTGGGTATGG + Intergenic
1103322439 12:120099942-120099964 CTGATTGCACAGTGTGGGGCGGG - Intronic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1105214628 13:18277091-18277113 CTGGCAGCCCTGAGTGGGGGTGG - Intergenic
1105734183 13:23250864-23250886 CTAGCACCACAGAGTGGGGTGGG + Intronic
1106463745 13:29994686-29994708 CTGGCTGGACGCAGTGGAGATGG + Intergenic
1108194382 13:47977417-47977439 CTGGCTTCATAGAGTGAGTATGG - Intronic
1108212751 13:48154872-48154894 CTGGTTGTGCAGAGAGGGGAGGG + Intergenic
1110268706 13:73568920-73568942 TTGACTGCACGGAGTTGGGAGGG - Intergenic
1110845727 13:80188613-80188635 CGGACTGTACAGAGTTGGGAAGG - Intergenic
1110978861 13:81871113-81871135 CGGACTGTACAGAGTTGGGAAGG - Intergenic
1111508646 13:89230567-89230589 CTGGCTACACAGAATGGGTTAGG + Intergenic
1111985102 13:95057970-95057992 CTGGCTGCAGAGGGTGGAGAAGG - Intronic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1112733232 13:102390170-102390192 GTTGCTTCTCAGAGTGGGGATGG + Intronic
1112758491 13:102667783-102667805 CTGGCTGCCCAGAGAAGGGCTGG - Intronic
1113095052 13:106654346-106654368 CTGTCAGAGCAGAGTGGGGAGGG + Intergenic
1113555795 13:111232973-111232995 CTGGGAGAACAGGGTGGGGATGG + Intronic
1113756741 13:112817577-112817599 CTGGCTGCAGAGAGTGTGAAGGG - Intronic
1113909041 13:113833241-113833263 CTGGCTGCCCACGGTGGGCAGGG - Intronic
1113959754 13:114119935-114119957 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959833 13:114120179-114120201 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959875 13:114120319-114120341 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959912 13:114120429-114120451 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959954 13:114120569-114120591 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1119617120 14:76106157-76106179 GTTGATGCACAGAGAGGGGAGGG - Intergenic
1119818330 14:77591307-77591329 GTGGCTGCCGAGGGTGGGGAGGG + Intronic
1121281439 14:92701982-92702004 CAGGCAGCACAGAGTGGGATGGG - Intergenic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1121978365 14:98428175-98428197 CTGGCTGTATAGAGTAAGGAAGG + Intergenic
1122035256 14:98944418-98944440 CTGGCTACACAAAGTGGGTTTGG - Intergenic
1122353139 14:101109033-101109055 CTGGCTGACCAGGGTGAGGATGG - Intergenic
1122606863 14:102952547-102952569 GTGGCTGCACTGAGTAGGGCTGG + Exonic
1122740374 14:103868533-103868555 CTGGGGGCCCAGAGTGGGCAGGG - Intergenic
1122929057 14:104925135-104925157 CCAGCTGCACGGACTGGGGACGG - Intronic
1202904297 14_GL000194v1_random:59616-59638 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1202920791 14_KI270723v1_random:29120-29142 TGGGCTGCAGAGAGTAGGGAAGG + Intergenic
1202924125 14_KI270724v1_random:8461-8483 TGGGCTGCAGAGAGTAGGGAAGG - Intergenic
1124032067 15:26020776-26020798 CTGGCAGCACAGAGTCTGGGGGG + Intergenic
1125769665 15:42156626-42156648 CAGGCAGCACTGAGTTGGGAGGG + Exonic
1125828099 15:42692800-42692822 CTGGAGGCACAGGGTGGGTAAGG - Exonic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126055874 15:44729176-44729198 CTGGCTGCACTGGGCTGGGAAGG - Exonic
1126992434 15:54395442-54395464 CTGACTCCACAGATTTGGGATGG - Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1129298704 15:74613508-74613530 CAGGCTGCAAAGTGTGGAGAGGG + Intronic
1129325923 15:74800285-74800307 CTGGAGTCACTGAGTGGGGAGGG - Intronic
1131071580 15:89469873-89469895 GGGGCTGCACAGGGAGGGGAGGG - Intergenic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1133388029 16:5386522-5386544 CTGAATGCAAAGAGTAGGGAGGG - Intergenic
1135133629 16:19872171-19872193 CTTGCCGCACAGAGTGAAGAGGG + Exonic
1135925170 16:26687634-26687656 CTGGCTGCATGGCTTGGGGATGG + Intergenic
1136140265 16:28283836-28283858 CTGGCAGGTCGGAGTGGGGAAGG - Intergenic
1136394835 16:29987201-29987223 CTGGCAGCCCAGGGTGGGGGTGG + Exonic
1136398048 16:30003792-30003814 CATGCTGCGCACAGTGGGGAAGG + Intronic
1136628610 16:31476712-31476734 ATGGCGGGACAGAGCGGGGAGGG - Intronic
1136751312 16:32638148-32638170 TTGGCTGCACAGAGAAGGCAGGG + Intergenic
1138563590 16:57816554-57816576 CTGGCTGCTCTGAGTGGCGGAGG + Intronic
1138756516 16:59492962-59492984 CTCGGGGCAGAGAGTGGGGAAGG + Intergenic
1140972480 16:80027113-80027135 CTGTCCCCACAGACTGGGGAGGG - Intergenic
1141071096 16:80955098-80955120 ATGGTTGCTCAGAGTGGGGGAGG - Intergenic
1141427740 16:83954775-83954797 CTGCCTGCAAAGGGTGGGAAGGG + Intronic
1141904333 16:87013553-87013575 CTGGCTGCCCTGAGCTGGGAGGG - Intergenic
1142083998 16:88166533-88166555 ATGGCTGGGAAGAGTGGGGAGGG - Intergenic
1142153903 16:88524572-88524594 CTGGCAGGACAAAGTGGGCATGG - Intronic
1203053446 16_KI270728v1_random:897403-897425 TTGGCTGCACAGAGAAGGCAGGG + Intergenic
1143015775 17:3890448-3890470 CTAGCTGGAAAGAGTGGGGCTGG - Intronic
1143057845 17:4175792-4175814 CTGGGAGGAGAGAGTGGGGAAGG + Intronic
1143066900 17:4256707-4256729 CTTGCAGAACAGAGAGGGGAAGG - Intronic
1143378138 17:6479336-6479358 CTGGCTGGACACTGTGGGGCAGG - Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143784649 17:9247393-9247415 CAGGCCACACAGGGTGGGGACGG - Intergenic
1144220167 17:13092577-13092599 GTGGCTGGACAGAGTGGGGTGGG + Intergenic
1144223567 17:13122415-13122437 GTGGCTGAACACAGTGGGGGAGG + Intergenic
1145178226 17:20720637-20720659 GTGGCTGCCCATAGTGGGAATGG - Intergenic
1146696372 17:34911683-34911705 GTGGCTGGAGAGAGTTGGGAGGG + Intergenic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1148026637 17:44593427-44593449 CTGGCTGCATGGGGTGGGGCAGG + Intergenic
1148438466 17:47699541-47699563 CAGTCTGCACACAGTGGGGAAGG - Intronic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1148975885 17:51527900-51527922 CCGGCTGCACGGTGTGGTGATGG + Intergenic
1149821193 17:59779366-59779388 CTGGCTGTGCTGAGTAGGGATGG + Intronic
1149837864 17:59930226-59930248 GTGGCTGCCCATAGTGGGAATGG - Intronic
1150221246 17:63497026-63497048 ATGGCTGCCCAGCCTGGGGAGGG - Intronic
1150301442 17:64050297-64050319 CAGGCTGCAGAGAGTGTGGGGGG - Intronic
1150471231 17:65439086-65439108 CTGGCTGCACACAGAAGGGATGG + Intergenic
1150630620 17:66877782-66877804 CTGGGAGCAGAGTGTGGGGAAGG - Intronic
1151482747 17:74379960-74379982 CAAGCTCCCCAGAGTGGGGAAGG - Intergenic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1151668132 17:75557323-75557345 CAGGCGGCAGAGAGTGGAGAGGG + Intronic
1151701057 17:75742768-75742790 CTGGGTGGGGAGAGTGGGGAAGG + Intronic
1151889184 17:76942124-76942146 CGGCCTAGACAGAGTGGGGAGGG + Intronic
1152433857 17:80263473-80263495 GGGGCAGCACAGAGCGGGGAGGG + Intronic
1152686209 17:81695017-81695039 CCGGCTGCACAGCCTGGGGAAGG + Exonic
1153262256 18:3236000-3236022 ATGGCTGAGCAGACTGGGGAGGG + Intergenic
1154293485 18:13130649-13130671 CTGGCTGCACCCAGTGGGGATGG - Intergenic
1155054437 18:22171593-22171615 CTGGCTGGAGAGAGCGGCGAGGG - Exonic
1155285829 18:24288257-24288279 GTTGCTGCACAGAGTGTAGAAGG + Intronic
1155294346 18:24371632-24371654 CAGGGAGCACAGAGTAGGGAGGG - Intronic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1157256595 18:46145071-46145093 GAGGCTGCACTGAGTGGTGATGG + Intergenic
1157436393 18:47673314-47673336 TTGCCATCACAGAGTGGGGAAGG + Intergenic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1157682719 18:49619500-49619522 CTGGCTGCTGGGAGTGGGGTAGG + Intergenic
1157783863 18:50464712-50464734 CCAGCTGCACAGGGTGGGGAAGG + Intergenic
1160291725 18:77600902-77600924 GTGGCAGCACAGAGAGGGGAAGG - Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1160828183 19:1090297-1090319 CTGGCTCCACAGGCGGGGGACGG + Intronic
1160993658 19:1872007-1872029 TTATCTGCACAGAGTCGGGAGGG + Intergenic
1161136021 19:2620330-2620352 CTGCCTGCAGAGAGAGGGGTCGG - Intronic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161300097 19:3538349-3538371 ATGGCTGCACGGCGTGGTGAAGG - Intronic
1161454017 19:4361343-4361365 CTGGCGCCATGGAGTGGGGAAGG + Exonic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1163668365 19:18613470-18613492 CTGGTAGCTCTGAGTGGGGAGGG - Intronic
1163764616 19:19155876-19155898 CTGGCTGGACAAAGCAGGGAGGG - Intronic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1164064751 19:21706357-21706379 CTGGCTCCACAAACTGAGGAGGG - Intergenic
1164826668 19:31289353-31289375 AAGGCTGCCCAGAGTGAGGAGGG - Intronic
1165771497 19:38383183-38383205 CTGGCCCCATAGGGTGGGGATGG + Intronic
1166345033 19:42160200-42160222 CTGGGTGGGCAGAGTGGAGAAGG + Intronic
1166993954 19:46710467-46710489 CTGGCTGGGCACAGTGGGGGAGG - Intronic
1167000828 19:46745360-46745382 GTGGCTGCACAGTGCAGGGAAGG - Intronic
1167249017 19:48391013-48391035 CGGGCTGCCCAGATTGGGGCTGG + Intronic
1167734277 19:51282351-51282373 CTGGCAACCCAGAGTGGGGCTGG - Intergenic
1167826685 19:51979673-51979695 CTGGGTCCACAGAGTGGGGTAGG - Intronic
1202715775 1_KI270714v1_random:41577-41599 CTGGCTGCAGGGCGTGGGGGCGG - Intergenic
925138275 2:1534410-1534432 GAGGCTGCACAGGGTGGGGGCGG - Intronic
926077673 2:9954426-9954448 CTACCTGAACACAGTGGGGAGGG - Intronic
926129773 2:10295515-10295537 GTGGCTCCACAGAGTTGGGTTGG - Intergenic
926177337 2:10606332-10606354 CTGCCTGCACAGACTGGGCGTGG + Intronic
927851232 2:26500979-26501001 CTGGCTGCTCAGAGGGGACAGGG - Intronic
928091433 2:28377298-28377320 CTGGCTGGGCAGGGTGGGGCAGG + Intergenic
928357826 2:30636554-30636576 ATGGCAGCACCGAGTGTGGAGGG - Intronic
929009028 2:37423048-37423070 CTGACTGCACAGATTGGCTATGG + Intergenic
929829663 2:45336566-45336588 CTGGCTTCACACTGTGGGCAGGG - Intergenic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
930551230 2:52837156-52837178 CTGGCTTCAAAGAGTGAGGAAGG - Intergenic
930769823 2:55120104-55120126 CTGGGTGTCCAGAGTGGGCATGG - Intergenic
931301996 2:60989283-60989305 CTGGCTGCATGGAGTGGGGTAGG - Intronic
932799189 2:74724330-74724352 CTGGCTGCGTAGAGTGAGGAAGG - Intergenic
932975531 2:76595602-76595624 CTGACTGCACAGTCTGGGGAGGG + Intergenic
933260414 2:80125787-80125809 CAGGCTGCAGAGATTAGGGATGG - Intronic
933779083 2:85788917-85788939 CAGACTGGACAGAGTGGGCATGG + Intergenic
933791615 2:85888325-85888347 CTGGCTGCAGAGAGGGTGCAGGG + Intronic
933881478 2:86674122-86674144 CTGGCTGCCAAGGATGGGGAAGG + Intronic
934299693 2:91769648-91769670 CTGGCAGCCCTGAGTGGGGGTGG + Intergenic
934861097 2:97764185-97764207 CTGGCTGCACAGTCTTGGGTGGG + Intronic
935179162 2:100674941-100674963 CTGGCTGAGCTCAGTGGGGAAGG + Intergenic
935227639 2:101067712-101067734 CTGGCTGCTGAAAGTTGGGATGG + Intronic
935852829 2:107241856-107241878 ATGGCTCCACTGAGCGGGGATGG + Intergenic
937295570 2:120807902-120807924 CTGGGTGGGCAGGGTGGGGAGGG + Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
937763681 2:125634802-125634824 TGGGCTGCAAAGAGTGGGGAGGG + Intergenic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
937988487 2:127649403-127649425 CTGGCTGTGCAGGGTGGGGATGG + Intronic
938953896 2:136281487-136281509 ATGGCTGCACAGGGAGGCGATGG + Intergenic
938983967 2:136554890-136554912 CTGGCAGCCCAGAGTAGGGAGGG + Intergenic
939831290 2:147074697-147074719 CTGGCTTCATAGAGTGAGTAAGG + Intergenic
941671778 2:168301507-168301529 CAGGCTGCGCCAAGTGGGGAAGG - Intergenic
942343337 2:174973665-174973687 CTGGCAGCACAAAGTGGGGTGGG - Intronic
944420661 2:199526533-199526555 CTGGCTTCCCAGAGTAGGAATGG - Intergenic
946416638 2:219543337-219543359 CGGGCTGCACCGAGTTGGGCCGG + Exonic
947264769 2:228266521-228266543 CTGCCTGCACATATTGGTGATGG - Intergenic
947430612 2:230024517-230024539 CAGGCTGCACAGGTAGGGGAAGG - Intergenic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
947788112 2:232842885-232842907 CTAACTGCACAGAGTGCGGGAGG + Intronic
947827773 2:233117989-233118011 CCTGCTGCACAGTCTGGGGATGG + Intronic
947874527 2:233459514-233459536 CTGACTGCTCAGTGAGGGGATGG + Intronic
948195163 2:236090171-236090193 CCAGCTGCACAGGCTGGGGATGG + Intronic
949035069 2:241812442-241812464 CTGGCTACACTGAGCGGGGCTGG + Intronic
1169289925 20:4340863-4340885 CAGGCTGCCCACAGTGGTGATGG + Intergenic
1169355065 20:4898880-4898902 AGGGCTCCACAGAGTCGGGAGGG + Intronic
1169413267 20:5392933-5392955 CTTGCTGCTCAAAGTGGGGTCGG - Intergenic
1169698476 20:8418896-8418918 CTGCCTACACAGAGGGGAGAGGG + Intronic
1170111542 20:12808989-12809011 CTGGCTGCAGTGTGTGGGGTGGG - Intergenic
1170312841 20:15011671-15011693 CTGGATGGAGAGAGAGGGGAAGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171343862 20:24451189-24451211 CTGGCTGTGCACCGTGGGGAGGG - Intergenic
1171982995 20:31640116-31640138 CTGGCTGGAGAGAGTGGGTTGGG + Intronic
1172006972 20:31824373-31824395 GTGGCTGCCCAGGATGGGGAGGG + Intronic
1172231992 20:33342945-33342967 CTGACTGCACAGGGTGGAGGTGG - Intergenic
1172813651 20:37669694-37669716 CTGGCAGCAGAGATTGGGAAGGG + Intergenic
1173455245 20:43196436-43196458 CTGGCTGCTGTGTGTGGGGAGGG - Intergenic
1173500682 20:43550553-43550575 CTGGGAGCGCAGAGAGGGGAGGG + Intronic
1174066105 20:47867277-47867299 GTGGCTGCACAGAGCGAGGCTGG - Intergenic
1174838714 20:53881488-53881510 CTTGCAGCATGGAGTGGGGAAGG + Intergenic
1175516874 20:59575688-59575710 CTGGGTCCACAGAGTGGGGAAGG + Intergenic
1175695467 20:61099921-61099943 CAGGCTGCACAGAGCAGCGAAGG + Intergenic
1175732090 20:61361081-61361103 CTGGCGTCATAGAGTTGGGAAGG + Intronic
1175774228 20:61642820-61642842 CTGGCTTCAGAGATGGGGGAAGG - Intronic
1175941402 20:62539065-62539087 ATGGCTGCCCAGAGCGGGGCAGG - Intergenic
1176023433 20:62974049-62974071 CAGGCTGCCTAGAGTGGGGGGGG - Intergenic
1176112157 20:63415691-63415713 CTGGCAGGACAGTGTGAGGAAGG - Intronic
1177376155 21:20273267-20273289 CAGACTGCAAAGATTGGGGAAGG + Intergenic
1177856525 21:26406252-26406274 GTGGCTGCACAGGCTGGAGAAGG + Intergenic
1178180288 21:30152489-30152511 CTTGCTGAGAAGAGTGGGGATGG + Intergenic
1178544373 21:33480414-33480436 CGAGCTGCCCAGAGTAGGGAAGG + Intergenic
1179594644 21:42434219-42434241 CTGGCTGCACAGTGAGGAGATGG + Intronic
1179922521 21:44514842-44514864 CTGGCTGCCCACCCTGGGGAAGG - Intronic
1179948920 21:44698638-44698660 CTGGCTGCAGACAGAGAGGATGG + Intronic
1180006026 21:45021127-45021149 CTGGCTGGACAGTCTGGGGAGGG - Intergenic
1180179255 21:46110753-46110775 CTGGCTCCGCAGAGTGGGGCTGG - Intronic
1180245677 21:46545862-46545884 CTGCCTGCACAAAGTGGAGAGGG - Exonic
1180631483 22:17233175-17233197 GGTGGTGCACAGAGTGGGGAGGG - Intergenic
1181698048 22:24603744-24603766 CTGGCAGCCCTGAGTGGGGGCGG + Intronic
1182000771 22:26917873-26917895 CTGGCTGAGCACAGTGGGGATGG + Intergenic
1182145341 22:27993781-27993803 CTGTCTGCGGAGAGTGTGGAAGG - Intronic
1183204601 22:36410083-36410105 CTGGCTGCGGCGAGTGGGGCTGG - Intergenic
1183245419 22:36689703-36689725 CTGGCTGCAGAGAGATGGGAGGG - Intronic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183440792 22:37822168-37822190 CTGGCTGCAGAGAGAGGAAAAGG + Intergenic
1183545442 22:38452806-38452828 CTGGCCCCTCAGAGTGAGGAGGG - Intronic
1183648405 22:39140071-39140093 GGGGCTGCAGAGAGTGTGGATGG - Intronic
1183669004 22:39261208-39261230 CAGGCTGCACAGAGTGGAGCAGG + Intergenic
1183686638 22:39364726-39364748 GTGGCTGCATAGGGTGGGGAGGG + Intronic
1184100282 22:42338401-42338423 ATGGCAGCGCAGAGTCGGGAGGG + Intronic
1184321074 22:43742660-43742682 GGGGCTGCGCAGAGTGGGGCTGG - Intronic
1184639689 22:45863819-45863841 GAGGGGGCACAGAGTGGGGAAGG - Intergenic
1184795193 22:46728170-46728192 CTGACAGCATGGAGTGGGGACGG - Intronic
1184910022 22:47525559-47525581 CAGACTGAACACAGTGGGGATGG + Intergenic
1185206416 22:49541546-49541568 CTGGCTGCCCAGCGAGGGGAGGG + Intronic
950881010 3:16322624-16322646 CAGGCTGCTCAGGGTGGGGTGGG + Intronic
951217916 3:20041220-20041242 CTGGGTGCAAGGAGTGGGGGTGG + Intronic
951266751 3:20577230-20577252 CAGGCAGCACAGTGTGGAGAAGG + Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951709321 3:25573186-25573208 CTGGAAGAACAGAGTGGGCAGGG - Intronic
953261983 3:41348481-41348503 CTGGCTTTACAGAGGAGGGATGG + Intronic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953850939 3:46464977-46464999 CTGGCCGCGGGGAGTGGGGAGGG - Exonic
954258191 3:49420583-49420605 CTCTCAGTACAGAGTGGGGAGGG - Intronic
954361491 3:50124983-50125005 CTGGCTGCAGGGGATGGGGATGG + Intergenic
956787463 3:72654413-72654435 CTGGCTTCACAAATTGGGGTTGG + Intergenic
957080747 3:75633844-75633866 TGGGCTGCAGAGAGTAGGGAAGG - Intergenic
961001920 3:123379660-123379682 GTGACTGCACAGAGCGGGGGTGG + Intronic
961477699 3:127158903-127158925 GTGGCTGGAGAGAGTGGGGACGG + Intergenic
962171357 3:133104801-133104823 ATGGCTGCACAGTGTGGGCAAGG - Intronic
962362555 3:134754410-134754432 ATGGCTGCCCAGTGTGAGGAGGG + Intronic
963742888 3:149097793-149097815 CTGGCAGCACAGGATGGGGGGGG + Intergenic
964739933 3:159954495-159954517 ATGGCTGCCCACATTGGGGAGGG + Intergenic
966622465 3:181980645-181980667 CTGCATGCACAGAGGGGGGGGGG + Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967949825 3:194832181-194832203 GCGGCGGCCCAGAGTGGGGAGGG + Intergenic
968955060 4:3714171-3714193 CAGGCAGCACAGAATAGGGAAGG - Intergenic
969197507 4:5574685-5574707 CTGGCTGCACAGGGTTGCAAAGG + Exonic
969308743 4:6340034-6340056 GAGGCTGTACACAGTGGGGAGGG + Intronic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
969471668 4:7392726-7392748 CAGGCATCACAGAGGGGGGAGGG + Intronic
970629187 4:17922885-17922907 ATGGCTGCCCAGGTTGGGGAAGG - Intronic
971349697 4:25844897-25844919 GTGTGTGCACATAGTGGGGAGGG - Intronic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
974905336 4:68048056-68048078 ATTGGTGCATAGAGTGGGGAAGG + Intergenic
975152950 4:71040889-71040911 CTGGCTGCATAGAATGGGTCAGG + Intergenic
975397900 4:73898881-73898903 CTGGTTGGACATAGTGGCGATGG - Intergenic
978479593 4:109174323-109174345 CTGTCAGGACAGAATGGGGAGGG - Intronic
978712302 4:111799057-111799079 TTCTATGCACAGAGTGGGGAGGG + Intergenic
979351263 4:119646772-119646794 CTGGCAGGACACAGAGGGGATGG - Intergenic
979633225 4:122926952-122926974 CTGGCAGCACAGAGTGCTGGAGG + Intronic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981600281 4:146480962-146480984 ATGGCTGCACAGAGAAGGGAAGG + Intronic
981632679 4:146838976-146838998 CTGGCTGGACAGAGGGGTCAGGG - Intronic
982325660 4:154126175-154126197 GGAGCTGAACAGAGTGGGGATGG - Intergenic
984751051 4:183275080-183275102 GTGGCTGGAGAGAGTAGGGAGGG - Intronic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985074880 4:186204481-186204503 CTTACTGCACAGGGTGTGGAGGG + Intronic
985671755 5:1210366-1210388 CCTCCTGCTCAGAGTGGGGATGG + Intronic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
986099599 5:4595031-4595053 CTGGCTGACCAGAGAGGGCAGGG - Intergenic
988607977 5:32697495-32697517 CTGGCTGCATAGAGTGAGTTTGG + Intronic
990878709 5:60517195-60517217 CTTGGTGCACAGAGTCTGGAGGG - Intronic
991385129 5:66079107-66079129 CTGGAAGCAAAGAATGGGGATGG + Intronic
993385038 5:87252538-87252560 CGGGCTGCAGGGAGCGGGGAGGG + Intergenic
995696757 5:114886806-114886828 CTGGCTTCATAGAGTGGGCTAGG + Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
998635383 5:143949005-143949027 CTGGCTGCACCTAGTTGGCAAGG + Intergenic
998887810 5:146712707-146712729 AGGGATGCACAGAGTGGTGAGGG - Intronic
999107326 5:149085349-149085371 CTTGCTGCACAGAGTGGGTGGGG - Intergenic
999687943 5:154118969-154118991 CTGGCTGCACAGCCTAGGGAAGG - Intronic
1001412751 5:171522433-171522455 ATGGAGGCACAGAGAGGGGAAGG - Intergenic
1002610296 5:180413405-180413427 CTTGATGCAAAGAGTGGAGACGG + Intergenic
1002908893 6:1473212-1473234 CAGGATGCACAGCGTGGGAAGGG - Intergenic
1003011008 6:2427577-2427599 CAGCCTCCACAGAGTGGGGAGGG + Intergenic
1003070952 6:2945317-2945339 ATGCCTGCACAGACTGGCGAAGG + Intergenic
1005118886 6:22368849-22368871 CTGGCAGGACTGTGTGGGGATGG + Intergenic
1005849839 6:29813203-29813225 CTGTCTGCTCAGAGCTGGGAGGG - Intergenic
1006174878 6:32115788-32115810 CTGGCTGCAGAGACTGGCAAGGG + Exonic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006315915 6:33291604-33291626 CTGGCTGCTATGAGTGGGGGTGG - Intronic
1006664234 6:35678232-35678254 TTGGCTGGAGGGAGTGGGGAGGG + Intronic
1007290878 6:40785821-40785843 CTGGGAGCAGTGAGTGGGGATGG - Intergenic
1007314827 6:40978972-40978994 GTGGCTACCCAGGGTGGGGACGG + Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1008315437 6:50033817-50033839 CTGGCTTCACAGAATGAGGTAGG - Intergenic
1008893765 6:56527561-56527583 CTGGCTGGACAAAGTGGAGGTGG - Exonic
1009500940 6:64413110-64413132 ATGGCTGCACAAGGTGAGGAAGG - Intronic
1009660471 6:66605237-66605259 CTGGCTCCACAGCTTGTGGATGG - Intergenic
1010050227 6:71495401-71495423 TTGGCTGCAAAGAATGGGGAAGG + Intergenic
1011741622 6:90366498-90366520 CTGGGTGCATAGAGGGGCGAAGG - Intergenic
1012054785 6:94392731-94392753 CTGGATTCAGAGAGAGGGGAAGG - Intergenic
1013240469 6:108240703-108240725 TTGGCAGCAAACAGTGGGGAAGG + Intronic
1013737951 6:113249097-113249119 GTGGCTGCTCAGGGTGGGGGAGG - Intergenic
1014214963 6:118744630-118744652 CAGCCTGCACAGTGCGGGGAGGG - Intergenic
1014403172 6:121015863-121015885 CTTGTTCCACAGAGTGGGGATGG - Intergenic
1015575427 6:134666110-134666132 CTGGCTGCAATGTGTGGAGAAGG - Intergenic
1016486259 6:144543040-144543062 TTGGCTGCCCAGTGTGGGTAAGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017268911 6:152483165-152483187 CTGGCTGTACAGAGCGGAGGTGG - Exonic
1018030199 6:159835686-159835708 CTGGCTGCCCAGATGGGGTAGGG + Intergenic
1018468020 6:164069564-164069586 CTGACTGCACAGGATGGGGTAGG + Intergenic
1018619330 6:165715005-165715027 CTGGGTGCACAGAGCAGGGCAGG + Intronic
1018848575 6:167572079-167572101 CTGACACCCCAGAGTGGGGATGG + Intergenic
1018945302 6:168343703-168343725 CTGGCTACACCATGTGGGGAGGG - Intergenic
1019219553 6:170463265-170463287 CTGGGTGCATAAAGTGGTGATGG + Intergenic
1019327514 7:445663-445685 GGGGCTGCAGAGAGTGGGGTGGG - Intergenic
1019328741 7:452489-452511 CTGGCTGCCAAGAGTGAGGATGG - Intergenic
1019416761 7:931192-931214 CTGCCTGGCCAGGGTGGGGACGG + Intronic
1019487848 7:1297432-1297454 CTGGCTGGACAGAGCGGGACAGG + Intergenic
1019697639 7:2455347-2455369 CCGGCTTCACAGAGTGAGGTAGG + Intergenic
1019718715 7:2555266-2555288 CTGACTTCAAAGTGTGGGGAGGG - Intronic
1020735995 7:11950066-11950088 GTGGCTGCTCAGGGTGGGGGAGG + Intergenic
1020743789 7:12055523-12055545 CTGTCTTTAGAGAGTGGGGATGG - Intergenic
1020818103 7:12931223-12931245 TTGGGTGCACAGAGTGGAAAGGG + Intergenic
1023664891 7:42512885-42512907 CTGGGTGCACATTGTGGGGTTGG - Intergenic
1024626188 7:51210156-51210178 CTGCCTTCACAGGGTGGGGCAGG - Intronic
1024941399 7:54767052-54767074 CTGGTTGCAGAGAGTGGCCATGG + Intergenic
1026252650 7:68684373-68684395 GTGGCTGCTCAGAGTTGGGGTGG - Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1030419511 7:109290165-109290187 CTGGCTGTACAAAGTGGAAATGG + Intergenic
1030643628 7:112034573-112034595 ATGGCTGCATGGAGTGGGCAGGG + Intronic
1030658765 7:112196634-112196656 CTGGTGACAGAGAGTGGGGAAGG + Intronic
1030900052 7:115112250-115112272 CTGCCTGCATACACTGGGGAGGG + Intergenic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1033416030 7:141162006-141162028 CTGGCTGCTCAGCGCTGGGAAGG - Intronic
1034449171 7:151128306-151128328 GTGGCTCCACACACTGGGGAGGG + Intronic
1034590107 7:152131488-152131510 CAGGCTGCAGAGCGTGAGGATGG + Intergenic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1034888237 7:154815710-154815732 CTTGCTGCTCTGAGTGGGAACGG + Intronic
1035060004 7:156062213-156062235 CTGGCCACACAGAGTGGGAAGGG - Intergenic
1035200265 7:157259092-157259114 CTGGCTGCACAGTGTGGTCCTGG + Intronic
1035261653 7:157665459-157665481 CCAGCTCCTCAGAGTGGGGAGGG - Intronic
1036738474 8:11340484-11340506 CTGGCTGCGTGGTGTGGGGAAGG + Intergenic
1037271617 8:17136632-17136654 GTAGCTGGACAGGGTGGGGAGGG - Intergenic
1037939015 8:22936587-22936609 CTGGCTTCACAGAGTGAGTCAGG - Intronic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1037940618 8:22948213-22948235 GTGGATGCAAAGTGTGGGGAAGG + Intronic
1039234670 8:35488777-35488799 CTGGTTTCACAGATTGGCGATGG + Intronic
1039378638 8:37063269-37063291 GTGGCTGCACACAGAGGAGAAGG - Intergenic
1039557345 8:38485952-38485974 CTGGCTGCACAGACCGTGGTGGG - Intergenic
1040075034 8:43220549-43220571 CTGTTTCCACAGAGTGGGCAGGG - Intergenic
1040402942 8:47071119-47071141 GAGGCTGCAGTGAGTGGGGATGG - Intergenic
1041381597 8:57258848-57258870 CTGGCTGCACAAAGGGTTGAGGG - Intergenic
1041624534 8:60010468-60010490 CAGAGTGCACAGTGTGGGGATGG + Intergenic
1043324879 8:79037546-79037568 CTGGCTGCATAGAATGAGTAAGG - Intergenic
1043569804 8:81589755-81589777 CTGCCTGCACAGAGGGGAAAAGG - Intergenic
1045287328 8:100803557-100803579 TTGGCTGTACAGGGTGGAGATGG + Intergenic
1047309253 8:123677851-123677873 CTGCCTGCAGAGAGAGGGAATGG - Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1048160532 8:132016872-132016894 CTGGCTGCATAGCGGAGGGAGGG - Intergenic
1048805290 8:138235655-138235677 CTGGCAGGGCAGGGTGGGGAGGG - Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1049719860 8:144110798-144110820 CTGGCTGGACTGAGTGGAGAAGG + Intronic
1050353706 9:4763501-4763523 CTGTCTGCCCAGAGTAGGGAAGG - Intergenic
1051606143 9:18919125-18919147 GGGGCTGCACAGGGTGGGGAAGG + Intergenic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1053307650 9:36995516-36995538 CTGGCTGTCAACAGTGGGGATGG + Intronic
1055934223 9:81589987-81590009 CATGCTGCACAGAGAAGGGACGG - Intronic
1055986887 9:82061986-82062008 CTGGATGCAGAGAGGGGTGAGGG - Intergenic
1056205575 9:84316465-84316487 CTTGCTGCCCAGTGTGAGGATGG + Intronic
1056969865 9:91193040-91193062 GTGGCTGCAGAGGGAGGGGAGGG - Intergenic
1057023062 9:91715564-91715586 CTGCCTCCAGAGAGTAGGGATGG + Intronic
1057037853 9:91824780-91824802 CTGGTTCCAGAGCGTGGGGACGG - Intronic
1057217492 9:93237101-93237123 CTGGCTTCAAGCAGTGGGGAGGG + Intronic
1057423155 9:94928058-94928080 CTTTCTGCACAGGATGGGGAAGG - Intronic
1059383260 9:113945100-113945122 CTGGCAGGACAGAGTGAGGTAGG - Intronic
1060367503 9:123033454-123033476 CAGACTGCACAGTGTGGGAATGG - Intronic
1061680500 9:132240617-132240639 CTAGTTGCCCAGAGAGGGGAAGG + Intronic
1061893494 9:133634951-133634973 CTGGGTGCAATCAGTGGGGAGGG + Intergenic
1062076895 9:134594523-134594545 CTGCCTGCACAGTGTTGGGTGGG - Intergenic
1062101611 9:134731477-134731499 CTGGCTGCAGAGGGAGAGGAAGG - Exonic
1062300460 9:135864783-135864805 CGGCCTGCATGGAGTGGGGAAGG - Intronic
1062517504 9:136943850-136943872 CTGGCTGCAGAACGTGGGTAGGG + Intronic
1062582075 9:137233184-137233206 GTGGCCGCAGAGAGTGGGCAGGG - Intronic
1203563254 Un_KI270744v1:74669-74691 CAGGCTGGGCACAGTGGGGAGGG - Intergenic
1190044535 X:47101454-47101476 CTGGCTGCATGGAGTGGGTAGGG - Intergenic
1190370352 X:49734387-49734409 ATGCCTGCCCACAGTGGGGAGGG - Intergenic
1192180625 X:68913582-68913604 GTGCCTACACAGAGTGGAGAAGG + Intergenic
1193250817 X:79288975-79288997 GTGGCTGCTCAGGGTGGGGGAGG - Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1193574013 X:83177555-83177577 ATGGCAGCACAGGTTGGGGAAGG + Intergenic
1199905392 X:152223549-152223571 GTGGCTGGCCAGAGTGAGGAAGG - Intronic
1200121086 X:153790923-153790945 CTGCCTGGGCACAGTGGGGACGG - Intronic
1200161373 X:154011576-154011598 CTGGCTGCACAGACCCGTGAGGG - Exonic
1200161520 X:154012281-154012303 CTGAAAGCACAGAGTGGGGCAGG + Intronic
1201160178 Y:11159825-11159847 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1201591216 Y:15616883-15616905 CAGGGTGCAGGGAGTGGGGAGGG + Intergenic
1201792396 Y:17856715-17856737 CTGGCTGGACAGAGTTGAGGAGG - Intergenic
1201809158 Y:18049271-18049293 CTGGCTGGACAGAGTTGAGGAGG + Intergenic
1202353933 Y:24025963-24025985 CTGGCTGGACAGAGTTGAGGAGG - Intergenic
1202516846 Y:25644149-25644171 CTGGCTGGACAGAGTTGAGGAGG + Intergenic