ID: 972398183

View in Genome Browser
Species Human (GRCh38)
Location 4:38674828-38674850
Sequence TGCCTGCCCCTTCCTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972398183_972398186 -10 Left 972398183 4:38674828-38674850 CCTCCCTCAGGAAGGGGCAGGCA 0: 1
1: 0
2: 2
3: 38
4: 336
Right 972398186 4:38674841-38674863 GGGGCAGGCAGTTGTCTGTAAGG 0: 1
1: 0
2: 3
3: 18
4: 197
972398183_972398187 25 Left 972398183 4:38674828-38674850 CCTCCCTCAGGAAGGGGCAGGCA 0: 1
1: 0
2: 2
3: 38
4: 336
Right 972398187 4:38674876-38674898 TAAATCATGCTCTAGCCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972398183 Original CRISPR TGCCTGCCCCTTCCTGAGGG AGG (reversed) Intronic
900089025 1:911231-911253 TGCCTGCCCGCCCCAGAGGGAGG - Intergenic
900396027 1:2453602-2453624 GTCCTGCCCCTGCCAGAGGGGGG - Intronic
900646343 1:3710366-3710388 TGCCTGCCCCTCCCTGGGCAAGG - Intronic
900807237 1:4775560-4775582 TGGCTGCACCTTGCTGGGGGCGG + Intronic
900902511 1:5526688-5526710 TGCCTGCACTTTCCTGGGAGAGG + Intergenic
901062295 1:6477332-6477354 AGCGTGCCCCTTCCAGAGGCAGG - Intronic
901066689 1:6497580-6497602 TGCCTCCACCTCCCGGAGGGCGG + Intronic
901506194 1:9687537-9687559 TGCCGTCCCCCGCCTGAGGGAGG - Intronic
902350173 1:15848214-15848236 TGCCGGCCCCTCCCGGAGCGCGG + Intronic
902360141 1:15937911-15937933 TCCCTGCCCCTTTCTGAAGGAGG + Exonic
902399513 1:16150410-16150432 TTGCTTCCCCTTCCTGTGGGGGG - Intronic
902527523 1:17068882-17068904 TGCCTTGCCCTCCCTGAGAGGGG - Exonic
903027942 1:20442901-20442923 CTCCTGGCCCTTCCTGAGAGAGG + Intergenic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
903670751 1:25034105-25034127 TGCCTTCCCCTTTCTGAGCCTGG - Intergenic
903970797 1:27117559-27117581 TGCCTGCCCCCTCCCCAGGCAGG - Intronic
904804022 1:33118397-33118419 TGACTCCCACTTCCTCAGGGAGG - Intronic
905627001 1:39495738-39495760 AGCCCGGCCCCTCCTGAGGGAGG + Intronic
905669935 1:39785033-39785055 AGCCCGGCCCCTCCTGAGGGAGG - Intronic
906254364 1:44336377-44336399 TGCCGTCCCTTTCCTGAAGGTGG + Intronic
906274529 1:44506298-44506320 TGCCAGCTCCTTCCTGATAGTGG + Intronic
907858337 1:58326003-58326025 GGCCTGCCACCTCCAGAGGGAGG - Intronic
907979851 1:59471035-59471057 TACCTCCCCTCTCCTGAGGGAGG + Intronic
909392793 1:75135532-75135554 TGCCTGGTGCTTCCAGAGGGAGG + Intronic
910194457 1:84625632-84625654 TGCCTGACCCTGGCTGGGGGAGG - Intergenic
911148990 1:94579490-94579512 AGCCTGCCCCTTCCTCTGGAAGG + Intergenic
911284531 1:95974287-95974309 TGCCTGCTCCTTCCTCCGGAAGG + Intergenic
913627470 1:120674005-120674027 TGTCTGCCCCTACTGGAGGGGGG - Intergenic
914562638 1:148835832-148835854 TGTCTGCCCCTACTTGGGGGGGG + Intronic
914967045 1:152269501-152269523 TGCCTGCCCCTTCCTCTTGAAGG + Intergenic
914969322 1:152292616-152292638 TGCCTGCCCCTTCCTCTTGAAGG - Intergenic
916886927 1:169078593-169078615 AGCCTGCCTCTTCCTGAAGCTGG + Intergenic
917789605 1:178491125-178491147 TGCCAGTCCCTGCCTGAGGCTGG + Intergenic
918839290 1:189513501-189513523 TGGCTGCCCCTTGGTGAAGGGGG - Intergenic
919006269 1:191902721-191902743 TGCCAGCCTCTTCCTCTGGGAGG - Intergenic
919790429 1:201286855-201286877 TTCCTTCCCCATCCTCAGGGAGG - Intronic
919931405 1:202223599-202223621 TGCCTGCCCCTTCCCTGAGGGGG - Intronic
920022297 1:202965569-202965591 TCCCTGCCCCAGCCTCAGGGAGG - Intronic
922566544 1:226605156-226605178 TGCCTGCCCCTTCCTTACCATGG - Exonic
922686128 1:227639988-227640010 TTCCTGCTACTTCCTGAAGGGGG + Intronic
922701520 1:227763871-227763893 TGCCTGCACCTGCCTGGGAGCGG - Intronic
922714312 1:227858955-227858977 TGCCTGCCCCTTCTTGGGCAGGG + Intergenic
922775203 1:228211358-228211380 TTGCTGCACCTTCCTGAGGCAGG - Intronic
922802203 1:228369612-228369634 TGCCTGCCCCAGCCTGAGCCTGG + Intronic
923306654 1:232694591-232694613 TGCGTGGTCCTTCCTGTGGGGGG + Intergenic
924561950 1:245164538-245164560 TGCCTGCCGTTTCCTGTGGCTGG - Intronic
1062934337 10:1374888-1374910 TGCCTTCCCCTCCCTAAGTGGGG - Intronic
1063879296 10:10514536-10514558 TTCCTGGCACTTCCTGAGGGAGG + Intergenic
1065342778 10:24723040-24723062 CCCCCGCCCCTTCCTGAGGCGGG + Intronic
1066667822 10:37803407-37803429 TGCCTGCCCCTTGCTCATGCTGG + Intronic
1068701335 10:60023284-60023306 TAGCTGCCTCTCCCTGAGGGTGG - Intergenic
1070088128 10:73256321-73256343 TGCCTGCCCCATGTTAAGGGTGG - Intronic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1070720725 10:78755173-78755195 TGCCTGCCCCTGCTTGGGGTGGG + Intergenic
1072289188 10:93947076-93947098 GGCCTGCCCCTTCCTGACCTGGG - Intronic
1072438426 10:95434082-95434104 TGCCTCTCCCCTCCAGAGGGTGG - Intronic
1072743433 10:97923883-97923905 TTCCAGCCCCTTCCTCAGGGTGG - Intronic
1073570953 10:104580833-104580855 TGGATGCCTCTTCCTGGGGGTGG + Intergenic
1074193136 10:111155285-111155307 TGACTGTCCCTTGCTGAGGCTGG + Intergenic
1074464169 10:113667259-113667281 TCCCTGTGCCTTGCTGAGGGGGG - Intergenic
1075022280 10:118960646-118960668 TGCCTGCCTCTTCATGGGGCTGG + Intergenic
1075553432 10:123411346-123411368 TGTCTGCCCCTCCCAGTGGGGGG + Intergenic
1075657971 10:124174357-124174379 TGCCTGTCCCTGCCTGAGGATGG - Intergenic
1075663442 10:124214190-124214212 TGCCTGCTGCTTCCTGGGTGTGG - Intergenic
1075916165 10:126169272-126169294 TGCCTGCCCCTTCCTAAATGCGG + Intronic
1076014598 10:127017775-127017797 TGCCAGCCCCTTCCCATGGGGGG + Intronic
1076829597 10:132987599-132987621 TGCCTGGTCCTTCCTGCCGGGGG - Intergenic
1077303836 11:1859042-1859064 TGCCTGCCTCCTCCTGCCGGGGG - Intronic
1078050473 11:7961176-7961198 TGCCTGCCCCTTCCCGGAGCAGG - Exonic
1078092937 11:8278559-8278581 TAACTTCCCCTTCCTGAGTGTGG + Intergenic
1078102231 11:8336758-8336780 TGCCTGCCACAACCTGAGGTGGG + Intergenic
1079080029 11:17407567-17407589 TGTCTGCCCCTCCCTCAGGCAGG - Intronic
1079180897 11:18192634-18192656 CTCCTGCCTTTTCCTGAGGGAGG - Intronic
1079587963 11:22149704-22149726 TGCCTGCTCCTTCCTCTGGAAGG + Intergenic
1083294394 11:61707362-61707384 TGCCTGCCCATGCCTGAGCAAGG - Intronic
1084321766 11:68377237-68377259 TGCAGGTCCCTTCCTGAGGCCGG + Intronic
1084762579 11:71283346-71283368 TGCCTCCCCATTCCTGAGGCTGG + Intergenic
1084776141 11:71377182-71377204 TGGCTGCTCCTTGCTCAGGGTGG + Intergenic
1084872114 11:72105375-72105397 TGCCTGCTCTTCCCTGAGGATGG - Intronic
1086328061 11:85724914-85724936 TTTCTTCCACTTCCTGAGGGAGG + Intronic
1087049135 11:93868550-93868572 TTCCTGCTACTTCCTGAAGGGGG + Intergenic
1089611424 11:119671600-119671622 TGCCTGGCGCTTCCTCAGGCAGG + Intronic
1091368290 11:135039537-135039559 TGCCAGCCTCTTCCTCAGGAAGG + Intergenic
1091663591 12:2402426-2402448 TGCCTGCCTCTTCCAGCTGGTGG - Intronic
1093996500 12:25648680-25648702 TGCCTGCCGCTGACTCAGGGAGG + Intergenic
1096550060 12:52366210-52366232 TGGCAGCCCCTTCATGAGAGAGG - Intronic
1097106448 12:56629180-56629202 TCCCGGCCACTTCCTGCGGGAGG + Intronic
1097959058 12:65514701-65514723 TGCCTCCCCCTGCCTGGGTGGGG - Intergenic
1100982304 12:100171314-100171336 TGCCTACCCCTTCCTGATCTGGG - Intergenic
1103189926 12:118992561-118992583 TACCTGCCCCTTCCGGATGTGGG - Intronic
1103556893 12:121771746-121771768 TGCCTGCTCCTTCCCCAGGCTGG + Intronic
1104602206 12:130161851-130161873 TGCCCGCATCTTCCTGAGGCTGG - Intergenic
1107349537 13:39499703-39499725 TGCCAGCTCCTTTCTCAGGGAGG - Intronic
1109072426 13:57786946-57786968 TGCCTGCTCCTTCCTCTGGGAGG + Intergenic
1110052644 13:70923828-70923850 GGCCTGCACCTTCTTGATGGAGG - Intergenic
1112435078 13:99386116-99386138 TGCCTGCCCCTCCCTGTGGCAGG + Intronic
1113333046 13:109349956-109349978 TCTCTGCCCCTTATTGAGGGTGG - Intergenic
1114407717 14:22472129-22472151 TGCCTGCCCTTCCTTGGGGGAGG - Intergenic
1115809675 14:37092662-37092684 TGCCTGCACCATCCTGAAGCTGG - Intronic
1116227608 14:42171692-42171714 TGCCTGCTCCTTCCTCTGGATGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1119087122 14:71749031-71749053 GACAAGCCCCTTCCTGAGGGAGG - Intergenic
1120414730 14:84205381-84205403 GGCCTGCCTCTACCTAAGGGAGG - Intergenic
1121713084 14:96053554-96053576 TGCCTGCTCCTTGCTGAGTCTGG - Intronic
1122817644 14:104321451-104321473 TTCCTGCCCCCTCCTGAGTCTGG + Intergenic
1122922610 14:104886202-104886224 AGGCTGCCTCTTCCTGAGCGTGG + Intronic
1124959810 15:34385831-34385853 TGCCTGCCGCTTCCTGTCTGGGG - Intronic
1124976437 15:34532052-34532074 TGCCTGCCGCTTCCTGTCTGGGG - Intronic
1125515849 15:40320665-40320687 TTCCTGGCCCTTTCTGAGGCAGG + Intergenic
1126812446 15:52421286-52421308 TACCAGGCCCTTCCTTAGGGTGG - Intronic
1128061491 15:64738476-64738498 TGCCTGGGCCTTTCTGAGAGGGG - Intergenic
1129166253 15:73779840-73779862 TGTCTGACCCATCCTGGGGGTGG + Intergenic
1129616280 15:77100979-77101001 GGCCAGCCCCTTGCTGAGGGAGG + Exonic
1130112098 15:80973967-80973989 AGCCTTTCCCTTCCTGAGGAAGG + Intronic
1131394258 15:92074269-92074291 TGCCTGCCCATTGCTGATGCAGG + Intronic
1132602811 16:781536-781558 TGCCTCACCCTCCCTGAGAGGGG - Intronic
1132802951 16:1763159-1763181 TGCCTGCCCCTCCCTGCAGCGGG + Intronic
1133593671 16:7270193-7270215 TTCCTGCTCCTGCCTGGGGGCGG - Intronic
1134034913 16:11022435-11022457 TGCCTCAGCCTTCCTGAGGCAGG + Intronic
1134184887 16:12076937-12076959 TGCCAGACCCTTCCAGGGGGTGG + Intronic
1136016119 16:27402268-27402290 TGCCTGCCTCTCCCTGAGTGTGG + Exonic
1136061280 16:27728318-27728340 TGCCTGTACCTACCTGAGTGAGG - Intronic
1136369923 16:29830054-29830076 TGCCTGGCTCCTCCAGAGGGAGG - Intronic
1138210587 16:55159850-55159872 CGCCTGCACCTGCCAGAGGGTGG - Intergenic
1138489092 16:57365825-57365847 TGTCTGGTCCTTTCTGAGGGAGG + Exonic
1142354661 16:89596830-89596852 TGCCTGGCCCTGCCTGAGCCAGG + Exonic
1142438973 16:90082190-90082212 TCCCAGCCGCGTCCTGAGGGAGG - Intronic
1143919404 17:10318925-10318947 TGCTTGCTTCTTCCTCAGGGTGG + Exonic
1143937401 17:10501245-10501267 TGCATGCTTCTTCCTCAGGGTGG + Exonic
1143939814 17:10528825-10528847 TGCATGCTTCTTCCTCAGGGTGG + Exonic
1145900392 17:28487167-28487189 GGCCTGCCACTTCCTGTGGCTGG - Intronic
1145913541 17:28556702-28556724 TGCCTGCCCCTCCCACAGGCTGG + Intronic
1147218283 17:38913340-38913362 TGCCAGACCCTCCCTGAGGGCGG - Intronic
1147322886 17:39656740-39656762 AGCCTGCCCCTTCCTGGGCAGGG + Intronic
1147430316 17:40366831-40366853 TGCCTTCCCCTTCCTGAAAGTGG - Intergenic
1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG + Exonic
1148547411 17:48528783-48528805 TGCCTGCACCTTCCTGGTTGTGG + Exonic
1151224505 17:72638685-72638707 TGCCTGCCCCATCATGGGAGCGG + Intergenic
1151621781 17:75250077-75250099 TTCCTTCCCGTTCCTGTGGGCGG - Intronic
1152609743 17:81309760-81309782 AGCCTCCCCCTTCCTGGGGCTGG - Intergenic
1152613969 17:81329544-81329566 GGCCAGCCCCTTCCTGGGAGAGG - Intronic
1152646151 17:81469403-81469425 GGCCTGCCCCTGCCTCAGGTGGG + Intergenic
1152649270 17:81484431-81484453 TGCCTGCCGGTTCCCGCGGGAGG - Intergenic
1152746614 17:82043302-82043324 GGTCTGTCCCCTCCTGAGGGTGG - Intergenic
1153229728 18:2924337-2924359 TGCCTGCCCCTCCCTGAGCACGG + Intronic
1154029943 18:10744885-10744907 TGCCCGCCCTGTCCTGAGAGGGG + Intronic
1154168859 18:12036390-12036412 TTCCTGCCCCTGCCCGAGGATGG + Intergenic
1155039306 18:22051700-22051722 TTCCTGCCTCTCCCTGGGGGAGG - Intergenic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1159254811 18:65931726-65931748 TGCCTGCCCCTTCCTCTGGAAGG - Intergenic
1160729662 19:635369-635391 TGCCAGGCCCTTCCAGAGTGAGG - Intergenic
1160871191 19:1278688-1278710 TGCCTGCCCCTGCCTGACCTGGG + Intronic
1160963469 19:1735082-1735104 TGCCTGCCCCTCCCCGGGTGGGG - Intergenic
1162096338 19:8312065-8312087 AGCCTGAGTCTTCCTGAGGGCGG - Intronic
1162729758 19:12711272-12711294 TGTGTGCCCCTGCCTGGGGGTGG - Intronic
1164237003 19:23346061-23346083 TTTCTGCCACTTCCTGAAGGGGG - Intronic
1164432958 19:28204067-28204089 TTCCTTCCCCTTCCTAAGAGAGG - Intergenic
1164525687 19:29011664-29011686 TGCCAGCCTCTTCCTGAAGGCGG + Intergenic
1164822934 19:31264223-31264245 TGCCTGTCACTGGCTGAGGGTGG - Intergenic
1165626266 19:37280735-37280757 TGCGGGCACCTTCCTGCGGGTGG + Intergenic
1166557435 19:43710267-43710289 TGCCTGACCCAGCCTGGGGGTGG - Intergenic
1166688523 19:44809727-44809749 CTCCAGCCCTTTCCTGAGGGAGG - Intronic
1167293412 19:48636412-48636434 TTCCTGCCCCTTACAGATGGTGG - Intronic
1167463491 19:49638445-49638467 CTCCTCCCCATTCCTGAGGGAGG - Intronic
1167608527 19:50494675-50494697 TGCCAGCTCTTTCCTGAGGGAGG - Intergenic
1167649778 19:50723000-50723022 TGCCTGGCCATTCCTAAGGAGGG - Intergenic
1168353387 19:55688642-55688664 TGCCTGGCCCCTCCCGTGGGTGG + Intronic
925681185 2:6422970-6422992 TGCCTGCCCCGACCTGAAGTTGG + Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
926610622 2:14942979-14943001 TGCGTTCCCTTTGCTGAGGGAGG - Intergenic
927135391 2:20092992-20093014 TGCCTGCCCCAGGCTTAGGGTGG + Intergenic
928012697 2:27625201-27625223 TGGCTGTCCCTTCCAGAGTGAGG - Intergenic
928451541 2:31382671-31382693 TCCCTCCCCCTTCCTGAGCTTGG - Intronic
929501271 2:42493575-42493597 TGCCTGCCCGTGGCTGACGGGGG + Exonic
931070998 2:58649857-58649879 TGCCTCCCACTTCCTGAGAAAGG - Intergenic
931994619 2:67828066-67828088 TGCCCTCCCCATCCTGAGTGAGG + Intergenic
933723093 2:85410460-85410482 TGCCTGCCCCTCCCTGTCGGGGG - Exonic
935173875 2:100631022-100631044 TGTCTGCAGCCTCCTGAGGGAGG + Intergenic
935734773 2:106097778-106097800 AGCCTGCCCCTTCCTCACGCAGG + Intronic
937304587 2:120863346-120863368 TGCTTGCCTCTTCCTGACCGCGG + Intronic
937941483 2:127289649-127289671 TGCCTGCCCCCACCCAAGGGTGG + Intronic
937988852 2:127651185-127651207 GGCCTGTGCCTTCCTGTGGGTGG + Exonic
938015662 2:127864934-127864956 TGCCTCCCGCTGACTGAGGGAGG - Exonic
938874334 2:135517625-135517647 TGCCTGTTCCTTCCTCTGGGAGG + Intronic
940707711 2:157125537-157125559 TTCCTTCCCCTGCCTGAGGGAGG - Intergenic
942543579 2:177039491-177039513 TCCCAGCACCTTGCTGAGGGTGG - Intergenic
943548801 2:189312717-189312739 AGCCTGCCCCTTCCTTTGGGAGG - Intergenic
944882356 2:204026433-204026455 TGCCACCCCCTTCCTGAAGGGGG + Intergenic
948124084 2:235552116-235552138 TGCAGGCCCCTTCCAGCGGGTGG - Intronic
948653876 2:239464979-239465001 TGCCTGCCACTGTCTGGGGGCGG + Intergenic
948689803 2:239694716-239694738 TGCCTGCTCCTTCAGGAGGGTGG + Intergenic
948860050 2:240748451-240748473 TGACAGCCACTTCCTGAGAGTGG - Intronic
949024383 2:241759248-241759270 GACCTGCCACTCCCTGAGGGAGG + Intronic
1169208854 20:3754627-3754649 TCCCTGCCCCTTTCTTGGGGGGG - Intronic
1171018377 20:21562063-21562085 TGCCTGCTCCATCCTCAGGCAGG + Intergenic
1171194556 20:23187092-23187114 AGCCTGGCTCTTCCTGAGGGTGG + Intergenic
1171405462 20:24909665-24909687 TTCCTGCTCCTTCCCCAGGGGGG + Intergenic
1171953350 20:31440767-31440789 GCCCTGCCCCTTCCTTAAGGAGG - Intronic
1172050830 20:32116462-32116484 TGCCTGTTGCTTCGTGAGGGTGG + Intronic
1172227746 20:33316594-33316616 GCCCTGCCACTTCCTGAGGGTGG - Intergenic
1173251273 20:41365403-41365425 TGGCTGCCCCTCCCTGCGTGGGG + Intronic
1173310618 20:41893372-41893394 TGCCTCCACCTTCCACAGGGAGG + Intergenic
1174410755 20:50333537-50333559 TGACAGCCCCTTCCTAAGGACGG - Intergenic
1175105410 20:56611332-56611354 GGCCTTCCCTTTCCTGTGGGAGG + Intergenic
1175164489 20:57033601-57033623 GGCCTGCCCCTTGCAGCGGGAGG - Intergenic
1175216821 20:57395646-57395668 TGCCTGGGCCTTACTGAGGTGGG + Intronic
1175466820 20:59194872-59194894 TGCTTGCTTGTTCCTGAGGGAGG + Intronic
1175574776 20:60052585-60052607 TGCCAGCCCCTTTTTGAGGCTGG - Intergenic
1175907492 20:62388044-62388066 CGCCTGCCGCTTCTTGAGGGTGG + Intronic
1175997062 20:62816689-62816711 CCCCTGCCCCTCCCTGAAGGCGG + Intronic
1176141741 20:63547855-63547877 TGCCTGGGCCTTGCAGAGGGCGG - Intergenic
1177546159 21:22561773-22561795 TGCCTGGTGCTTCCAGAGGGTGG - Intergenic
1178493233 21:33067587-33067609 TGGGTGCCCCTTCCTGTGGGTGG + Intergenic
1178893347 21:36538844-36538866 TGTCTGCCCATTCCTGAGTTGGG - Intronic
1179873892 21:44257816-44257838 TGCCTGGCGCCTTCTGAGGGAGG - Intronic
1180178952 21:46109458-46109480 GGCCTGCCCCAGCCTGAAGGTGG + Intronic
1181024511 22:20120423-20120445 GCCCAGGCCCTTCCTGAGGGAGG + Intronic
1181596568 22:23918811-23918833 TGGCTGCCCTTTCTTGCGGGGGG + Intergenic
1181674514 22:24442890-24442912 AACCTGCCCCTGCCTGAGGTTGG + Intergenic
1182360632 22:29744524-29744546 TGCCTGCCTTTCCCTGAGGTGGG + Intronic
1182542058 22:31048932-31048954 TGCCTTCCCCTCCCTGGGTGGGG - Intergenic
1182622841 22:31627305-31627327 TGCCGGCACCTTCCCAAGGGAGG - Intronic
1183050586 22:35257731-35257753 CTCCAGCCCCTTCCTGGGGGCGG - Intronic
1183077009 22:35433641-35433663 GTCCTGCCCCTTCTTGGGGGTGG + Intergenic
1184610049 22:45597595-45597617 TGCCTGCCCCTCCCTGGGCTGGG - Intronic
1185068114 22:48642069-48642091 GGCCTGCACTTTTCTGAGGGGGG + Intronic
1185093873 22:48795138-48795160 TTCCTGCACCTTACAGAGGGGGG - Intronic
950668633 3:14512147-14512169 TGCCTGCCCCTTCCTGCCTCTGG - Intronic
950726219 3:14918713-14918735 TCCCTGCCCCACCCTGAAGGAGG + Intronic
950884720 3:16353308-16353330 TGCCTGCCCCTCTCTAAGGCTGG - Intronic
953383693 3:42492802-42492824 TGCAGTCCCCTTCCTGAGGTGGG - Intronic
953598046 3:44336699-44336721 TGGCCCCCCCTTCATGAGGGAGG + Intergenic
955864860 3:63371878-63371900 TTCCTTCCCCATCCTGAGGGTGG - Intronic
956097081 3:65728096-65728118 TTCCAGACCCTTCCTGAGTGTGG - Intronic
957917783 3:86708713-86708735 TGCCTGATCCTTCCTCAGGAAGG + Intergenic
959139520 3:102469114-102469136 TGACTGCCCCTTCCTTATGCCGG + Exonic
959993524 3:112655155-112655177 TGCCTGCCCCTGCTGGAGGAAGG - Intergenic
960898052 3:122526940-122526962 TGCATCCCTCCTCCTGAGGGTGG - Intergenic
963401644 3:144806347-144806369 TGCCTGCTCCTTCCTCTGGAAGG + Intergenic
964274341 3:154992835-154992857 TGACTGTCCTTTCCTGAGTGAGG - Intergenic
964385110 3:156138919-156138941 TGCCTGCCCCGTCCTGCTGATGG - Intronic
964387957 3:156169403-156169425 TGCCCGTTCCTTCCTGAGGAGGG - Intronic
964596825 3:158442146-158442168 TGGCTGCCCATTGATGAGGGTGG + Intronic
964760966 3:160134731-160134753 TGCCTGACCTTTCCTGAGTTAGG + Intergenic
965299957 3:166996738-166996760 TTACTGCCACTTCCTGTGGGAGG + Intergenic
966152169 3:176877113-176877135 GGCCTGCCCCTCCCTCTGGGGGG - Intergenic
966248699 3:177837729-177837751 TCCCTGTCCCTGCCTGATGGGGG + Intergenic
966852710 3:184174680-184174702 CGCCTACCCCTTCCTGAGGCGGG + Intronic
967841330 3:194007250-194007272 TGACTGCCCCTCCCTGAAAGAGG + Intergenic
967873902 3:194253298-194253320 TGCCAGCCCCTTCTTGCTGGTGG + Intergenic
968472276 4:787628-787650 TCCCTGCCCCTTCCTGCGTCTGG - Intronic
969584744 4:8085202-8085224 TGGCTGCCCCTCCCTGGGGAGGG - Intronic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
974950237 4:68577790-68577812 TTCCTGCTACTTCCTGAAGGGGG - Intronic
975992893 4:80279038-80279060 TCCCTGCTCCCTCCTGAGGTTGG + Intronic
976300180 4:83509230-83509252 TTCCTGCTACTTCCTGAAGGGGG + Intronic
981150590 4:141376216-141376238 TGCTTCCCCCTCCCTTAGGGTGG + Intergenic
982176966 4:152715056-152715078 GGCCTGCATCTTCCTGATGGTGG - Intronic
984998209 4:185457326-185457348 TGCCTGCCCTTTCCTGTAGGTGG - Intronic
985786444 5:1897813-1897835 TGCCTGCCTGTGCCTGAGGGAGG + Intergenic
986710850 5:10486946-10486968 AGCCTGCGCCTCCCGGAGGGAGG + Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
991206036 5:64051289-64051311 TGCCTGCACCTTGGTGAGTGGGG - Intergenic
991443363 5:66674926-66674948 TGCCTGCCATTTTCTGAGAGTGG - Intronic
992179480 5:74182789-74182811 TGCCTGCCCCTCCCTTTGGCTGG + Intergenic
992383753 5:76264787-76264809 TGCCTGCTCCTTCCTCTGGAAGG + Intronic
994968427 5:106703779-106703801 TGGCTCCCTCTTCCTGGGGGAGG + Intergenic
996977023 5:129447281-129447303 TGCCTTCCCCTTCCACAGGCTGG + Intergenic
997092187 5:130871026-130871048 TCCCAGCTTCTTCCTGAGGGAGG + Intergenic
997818195 5:137038031-137038053 TGTATGCCCTTGCCTGAGGGTGG + Intronic
998062846 5:139132757-139132779 TGCCTGCCACTTCTTGAGTAAGG - Intronic
998459018 5:142295632-142295654 TGCCTGCTCCCTCCCCAGGGAGG + Intergenic
998737128 5:145155069-145155091 TGGCTGGGTCTTCCTGAGGGTGG - Intergenic
999372714 5:151065608-151065630 TCCCTTCCCCTCTCTGAGGGAGG + Intronic
999824744 5:155263292-155263314 TACCTGCCCCTTCTTGGGTGTGG - Intergenic
1001147813 5:169200151-169200173 CCCCTTCCCTTTCCTGAGGGAGG - Intronic
1001926797 5:175643106-175643128 TGACTGCCCCTTCCAGAGGCAGG - Intergenic
1003342253 6:5233145-5233167 TGCCTCCCATTTCCTGAGAGAGG + Intronic
1004205841 6:13591571-13591593 TGCCTGTCTCTGCCTTAGGGAGG + Intronic
1004920202 6:20369111-20369133 TCACAGTCCCTTCCTGAGGGAGG + Intergenic
1005083587 6:21981321-21981343 TGCCTCCTCCTTCCTGAGCTGGG + Intergenic
1005321146 6:24655625-24655647 TGCATGCCCCTCCCTGTGGCTGG - Intronic
1006152902 6:31998792-31998814 TCCCTGCCCCTTGCTGAGCCAGG + Exonic
1006159210 6:32031529-32031551 TCCCTGCCCCTTGCTGAGCCAGG + Exonic
1006188226 6:32192226-32192248 AGCCTTCCTCATCCTGAGGGGGG + Exonic
1006338602 6:33433570-33433592 TACCTGCCCAATCCTGGGGGTGG - Intronic
1006855675 6:37131540-37131562 TGGCTGCCCCTCCCTGAGATGGG + Intergenic
1007093787 6:39200914-39200936 TGCCTGCCCATGTCTGAAGGTGG - Intronic
1007465004 6:42045677-42045699 GGCCTGCCCCTTTCTAGGGGTGG - Intronic
1007704351 6:43781736-43781758 TGCCCGCCTCTTCCTGCGGCAGG + Intronic
1007799591 6:44380874-44380896 GGCCTCCCCATTCCTGAGGGTGG - Intergenic
1007952923 6:45888132-45888154 AGCCTGCCCCTTCCCTGGGGTGG + Intergenic
1009905823 6:69868366-69868388 TAAATGCCCCTTCCTGAGGAGGG + Intronic
1010185495 6:73139086-73139108 TGCCTGCCTCCTCCTCAGGCTGG + Intronic
1014276607 6:119396359-119396381 TTACTGCCACTTCCTGTGGGAGG + Intergenic
1014990309 6:128067191-128067213 TGCCTGATCGTTACTGAGGGTGG + Intronic
1015328344 6:131950373-131950395 TGACTGCCCCTTCCCGAGGAGGG - Exonic
1015387055 6:132635915-132635937 TGCCTGCTCCTTCCTCTGGAAGG - Intergenic
1016292182 6:142538085-142538107 TTCCTGCTACTTCCTGAAGGGGG - Intergenic
1016894145 6:149036166-149036188 TGCCTGCCCCTGGCTGTGGAGGG + Intronic
1017028146 6:150198438-150198460 GAGCTGCCCCTTGCTGAGGGAGG + Intronic
1017124378 6:151051876-151051898 TGGCTGCGCCCTCCTGAGGGAGG + Intronic
1017945879 6:159095887-159095909 TGCCAGGCTCTTCCTGAGGGCGG + Intergenic
1018795958 6:167185882-167185904 CTCTTGACCCTTCCTGAGGGTGG + Intronic
1018820360 6:167369182-167369204 CTCTTGACCCTTCCTGAGGGTGG - Intronic
1019464811 7:1181745-1181767 TTCCTGCCTCTTCCTGATCGTGG - Intergenic
1019614589 7:1953391-1953413 TGCCTGCTCCTCCCTGGCGGGGG - Intronic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1019794385 7:3038997-3039019 TGCCAGCCTCTTCCTGTGGCAGG - Intronic
1019805191 7:3118329-3118351 TGCCTCACCCCTCCTGAGTGTGG - Intergenic
1020066843 7:5194925-5194947 GGCCTGCCCATTCCTGAGCCTGG - Intronic
1021240416 7:18193850-18193872 TGCCTGGCAATTCCTGAAGGTGG + Intronic
1021352019 7:19605621-19605643 TGGCTGCCCCTGGCTGGGGGTGG - Intergenic
1021790223 7:24197260-24197282 TGCCTACCCCTTAATGTGGGGGG - Intergenic
1023873636 7:44275750-44275772 TGCCTGCCCCTCCCAGGGGGAGG - Intronic
1024141227 7:46465171-46465193 TTACTGCCACTTCCTGTGGGAGG + Intergenic
1025797929 7:64757383-64757405 TGCCGTCCCCTTCCACAGGGTGG - Intergenic
1028720424 7:94024249-94024271 TTCCTGCCCCTACCTGGGTGTGG + Intergenic
1031978795 7:128110864-128110886 GACCTGCCCCTACCTGAGTGGGG - Intergenic
1033362151 7:140645309-140645331 TGCCTGTTCCTTCCAGAGGGGGG + Intronic
1035061675 7:156074189-156074211 TGCCTACCCCGTCCTGGGTGTGG + Intergenic
1035359283 7:158299763-158299785 GCTCTGCCACTTCCTGAGGGAGG - Intronic
1036751111 8:11444222-11444244 TACCTGGCCCTTCCCGAGGCCGG - Exonic
1037720525 8:21439714-21439736 TCCATGCCCCTTCCTGGTGGTGG - Intergenic
1037824243 8:22151531-22151553 TGCCTGCACCATCCTGAAGTGGG - Exonic
1037974275 8:23199108-23199130 TGCCTGTCCCCTTGTGAGGGTGG + Intronic
1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG + Intronic
1039407954 8:37328770-37328792 TGCTGGCTCCTTCCTGTGGGTGG + Intergenic
1039576229 8:38626084-38626106 TGGCTGCCCTTTCCTGCAGGAGG - Intergenic
1040958575 8:53006050-53006072 TGCCTGGCCCTTCCTTGGGCAGG - Intergenic
1042130645 8:65584033-65584055 GCACTGCCCCTTCCTCAGGGAGG - Intergenic
1042157889 8:65864768-65864790 TTCCTGCTACTTCCTGAAGGGGG - Intergenic
1042568274 8:70134607-70134629 TGCCTGCCTCCTCCTGACAGTGG - Intronic
1042889015 8:73586401-73586423 TGCCTACCCCTTCCTAATAGGGG + Intronic
1043259612 8:78180236-78180258 TAGCTGCCCTTCCCTGAGGGGGG - Intergenic
1047207134 8:122811571-122811593 TGTCTGCCCCTATCAGAGGGCGG - Intronic
1048568569 8:135630176-135630198 TGCCTGTGCTTTCCTGAGGAAGG + Intronic
1049421160 8:142517269-142517291 TGACTGCCCCTTCCTAGGGAGGG - Intronic
1049431729 8:142568489-142568511 TCCCTGCCCCTTGCTGAGCTGGG + Intergenic
1049473046 8:142784727-142784749 AGCCTGCCCCTTCCAGGGTGGGG + Intergenic
1049745845 8:144262958-144262980 TGCCCGGCCCTTCCTGTTGGTGG - Exonic
1050978047 9:11967157-11967179 TGCATGCTCCCTCCTGAGAGGGG + Intergenic
1052237931 9:26235067-26235089 TGCCCCCTCATTCCTGAGGGAGG - Intergenic
1053056110 9:34993952-34993974 TCCCTGCCACTTCCTCTGGGAGG - Intronic
1053593252 9:39534120-39534142 TCCCTGCCCCTTCCCGGGGCCGG - Intergenic
1053850986 9:42288828-42288850 TCCCTGCCCCTTCCCGGGGCCGG - Intergenic
1054573054 9:66831157-66831179 TCCCTGCCCCTTCCCGGGGCCGG + Intergenic
1056832002 9:89924776-89924798 TGCTTGCACCTTCCAGTGGGTGG - Intergenic
1057337395 9:94166523-94166545 GGCCTGCCCCCTCCAGCGGGCGG + Intergenic
1057604167 9:96486891-96486913 TTCCTGCCCCTTCCTGCAGTGGG + Intronic
1057692519 9:97297852-97297874 TGTCTGAGCCTGCCTGAGGGTGG - Intergenic
1058619295 9:106865245-106865267 TGCCTTGCCTTTCCTGAAGGAGG - Intronic
1060400525 9:123346248-123346270 TGCCAGACCCTTGCAGAGGGTGG + Intergenic
1060520700 9:124292423-124292445 TGTCTGCCCCTTCCTGCCTGTGG + Intronic
1060592921 9:124830620-124830642 TGCCAGGCCCATCCTGAGTGTGG + Intergenic
1060816973 9:126640182-126640204 TGCCTGCTGCTTCCAGAGCGGGG + Intronic
1060995666 9:127873872-127873894 TCTCTGCCCCTTCCCCAGGGAGG + Intronic
1061043059 9:128150762-128150784 GGCTTGCTCCTTCCTGAAGGGGG - Intronic
1061260002 9:129474954-129474976 TGCCTGCACTTTCCCAAGGGAGG - Intergenic
1061282820 9:129607264-129607286 GGTCTGCCCCTTCCTGTTGGAGG - Intergenic
1061868120 9:133505903-133505925 TGCCTGAGCCTTCCAGAGGTAGG - Intergenic
1062080602 9:134621461-134621483 CACCTGCCCCTTCCCGAGGTTGG - Intergenic
1062138844 9:134944355-134944377 TGCCAGCCCCTCCCGGATGGAGG + Intergenic
1062344470 9:136108552-136108574 GGCCTGTCCCATCCCGAGGGAGG + Intergenic
1185601319 X:1341639-1341661 TGCTTGCCCCTTCCAGAGCCTGG - Intronic
1185681719 X:1893966-1893988 TAGCTGCCCCTTCCTGTGGACGG - Intergenic
1185990528 X:4889928-4889950 TGGCTGGGTCTTCCTGAGGGTGG - Intergenic
1195295653 X:103473838-103473860 TGCCTGCAGCTTTCTGAGGCTGG - Intergenic
1196740550 X:119021616-119021638 TGCCTGCCCCTGACTTAGCGGGG + Intergenic
1197126640 X:122954669-122954691 TACCTGCCCCTACTTGAGGCAGG - Intergenic
1197717317 X:129718884-129718906 AGGCTGCCCCTTCATGAGAGAGG - Intergenic
1197772487 X:130098103-130098125 TGCCTGCCCATGGCTCAGGGGGG - Intronic
1200001871 X:153066355-153066377 TGGCTGCCCCTACCTGGGGTGGG - Intergenic
1200005862 X:153083670-153083692 TGGCTGCCCCTACCTGGGGTGGG + Intergenic
1200240179 X:154489249-154489271 TGCCTCTCCATTCCTGAGTGTGG - Intronic
1200938716 Y:8760886-8760908 TGCATGCACATTCCTGAGGAAGG + Intergenic
1201686014 Y:16703121-16703143 TGGGTGGCCCTTCCTGAGGGTGG + Intergenic