ID: 972400163

View in Genome Browser
Species Human (GRCh38)
Location 4:38694228-38694250
Sequence GTCTCAGGAAACCACATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972400163 Original CRISPR GTCTCAGGAAACCACATTGT AGG (reversed) Intronic
902188561 1:14743931-14743953 GCTTCAGGAAACCTCATTCTTGG - Intronic
905596946 1:39215698-39215720 GTATCAGGAAACCACTTTTAAGG + Intronic
909198832 1:72662552-72662574 GTCTCAGGAGAGCACATTTGTGG + Intergenic
911422858 1:97666629-97666651 GTATCAGGAAAACATATTTTTGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
922349611 1:224724425-224724447 ATGTCAGGAAACTACATTCTGGG - Intronic
923702969 1:236317413-236317435 GTCACAGCAAACCACATAGCTGG + Intergenic
1063541592 10:6939540-6939562 ATCCCAGGAAACCACTGTGTGGG + Intergenic
1066094485 10:32059121-32059143 TTCTCAGGAAACCACTTTAAAGG + Intergenic
1068271059 10:54725124-54725146 GGCTCATGAACCCACAGTGTTGG - Intronic
1068633689 10:59324802-59324824 ATCTAAAGAAACCACAATGTGGG + Intronic
1071784889 10:88888084-88888106 GAATCAGGAAACCACAGGGTTGG + Intronic
1073615008 10:104985277-104985299 ATCTCAAGAAACCACTTTCTTGG + Intronic
1073950234 10:108800007-108800029 GTCTCAGAGAAACAAATTGTAGG - Intergenic
1078676045 11:13415317-13415339 TTCTCATGAAAGCAGATTGTTGG + Intronic
1080527247 11:33136111-33136133 GACTCAGGAAAGCATAATGTGGG - Intronic
1083696284 11:64444872-64444894 GTCTCAGTCACCCACAATGTTGG + Intergenic
1085444098 11:76589309-76589331 GGCTCTGGAAACCACAGTCTGGG - Intergenic
1086264671 11:84983409-84983431 CTCTCAGGAAGCCACATCCTAGG + Intronic
1088181165 11:107113531-107113553 GTATCTGGAAACTACATTATGGG + Intergenic
1095139388 12:38642938-38642960 CTCTCAAGAAACCATATTTTTGG - Intergenic
1095606394 12:44072789-44072811 GATTTAGAAAACCACATTGTCGG + Intronic
1096419694 12:51446522-51446544 GCCTTAGGAAACCCCATTGCTGG + Intronic
1096882618 12:54685173-54685195 GGCACAGAAAACCACACTGTGGG - Intergenic
1099158346 12:79208226-79208248 GTTTCAGGAGATGACATTGTGGG + Intronic
1101866330 12:108523208-108523230 ATCTCAGGACACCACATCCTGGG + Exonic
1103303559 12:119946476-119946498 ATCCCAGGAAACAACAGTGTGGG - Intergenic
1103790578 12:123467829-123467851 GTCTCAGAAAACAACCTTGCAGG + Intronic
1107000404 13:35537743-35537765 GTGACAGGAAACAACATGGTAGG + Intronic
1108453459 13:50589555-50589577 GTCTCAGGAAATCTCATCATAGG + Intronic
1108706997 13:52998285-52998307 CTCTCAGGAAAGGGCATTGTGGG + Intergenic
1109126061 13:58518591-58518613 ATCTCAGCAAACCACTTTCTTGG - Intergenic
1109265691 13:60197713-60197735 ATCTCAAGAAACCACTTTCTTGG + Intergenic
1110345936 13:74448005-74448027 GTCTCAGTAACACACACTGTGGG + Intergenic
1111608065 13:90566112-90566134 TTCTCAGGAAACCACCATGAAGG + Intergenic
1114939712 14:27593080-27593102 GACTCAGGAAACAAAAATGTGGG + Intergenic
1115460591 14:33655834-33655856 GTCTCAAAAAACCACAAAGTTGG + Intronic
1116999233 14:51355263-51355285 GTCTCAGGAAACATCCTGGTGGG + Intergenic
1118214121 14:63792293-63792315 GTCTCAGCATCCCAAATTGTTGG - Intergenic
1119030085 14:71185387-71185409 GTCTCAGTAATACCCATTGTTGG - Intergenic
1120712043 14:87803091-87803113 GCCTCAGAAAACAGCATTGTAGG - Intergenic
1122318293 14:100838345-100838367 GTCTCAGGCAAACACATATTTGG + Intergenic
1123134969 14:106019178-106019200 GTCTCAGGACACCATATTTCAGG - Intergenic
1124239795 15:28019788-28019810 TTCTCAGGGAATCACCTTGTGGG + Intronic
1124637534 15:31374573-31374595 GTCTCAGGAATTCACATTCCAGG + Exonic
1124834825 15:33186315-33186337 GTCTCAGGAAACATGATTGGTGG - Intronic
1125096259 15:35855800-35855822 GTCACTGGAAACCAAATTGTGGG + Intergenic
1125252610 15:37723131-37723153 ATCTCAAGAAACCACTTTCTTGG + Intergenic
1128712875 15:69885203-69885225 GGCTGAGAAAGCCACATTGTGGG + Intergenic
1128747419 15:70124313-70124335 GTCCCAGGCACCTACATTGTTGG - Intergenic
1137835750 16:51590811-51590833 GCTTCAGCAAACCACCTTGTGGG - Intergenic
1139238484 16:65365734-65365756 TTCTCAGGACACAACAATGTAGG - Intergenic
1140266594 16:73426438-73426460 GCCTCAGGAAATCACATTAATGG + Intergenic
1141292200 16:82728954-82728976 ATCTCAAGAAACCACTTTCTTGG + Intronic
1147849991 17:43434977-43434999 GACTCAGGAAACCACATCAAGGG - Intergenic
1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG + Intergenic
1151181176 17:72329755-72329777 GAATCTGGAAACCTCATTGTTGG - Intergenic
1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG + Exonic
1155809846 18:30218290-30218312 ATCTCAAGAAACCACTTTTTTGG + Intergenic
1157612961 18:48970014-48970036 CACTCAGGAAACCCCATTGAGGG - Intergenic
1160890911 19:1378269-1378291 CTCTCAGGAACCCACAATGGAGG - Exonic
1161272352 19:3397105-3397127 CCCTCAGGAAACCACATTGTTGG + Intronic
1163398193 19:17076170-17076192 GTCGCAGGAAACGGCGTTGTGGG + Intronic
1167627111 19:50598337-50598359 ATCTCAAGAAACCACTTTCTTGG - Intergenic
1167684896 19:50950082-50950104 GTCACAGGAAACATCATTGTTGG + Exonic
927363422 2:22264343-22264365 GTCTCAGGAAGCCACATCCCTGG - Intergenic
929270611 2:39967276-39967298 GACTCAGGAAAACACTTTATGGG + Intergenic
935113621 2:100114382-100114404 GTCTCAGAAAAACACAGTGCAGG - Intronic
935168701 2:100592420-100592442 CTCTCAAGAAACCACTTTCTTGG + Intergenic
939171150 2:138697619-138697641 GTCTCAGGATAATACATTCTTGG + Intronic
940995259 2:160142709-160142731 GCCTCAGGAAAAAACACTGTGGG - Intronic
943534559 2:189131679-189131701 GCTTCAGGAAAACACATTGATGG + Intronic
945176995 2:207053066-207053088 GTCTGAGGAAACCAAAATGGTGG + Intergenic
1168800552 20:641856-641878 GTCCCAGGCAACCAGATTGGGGG - Intergenic
1169247493 20:4034977-4034999 GTCGCCCAAAACCACATTGTGGG - Intergenic
1170502177 20:16985932-16985954 ATCTCAAGAAACCACTTTCTTGG - Intergenic
1175219686 20:57409711-57409733 CTCTCAGGAACCCACATTCAGGG - Intergenic
1182425345 22:30268554-30268576 GCCCCAGGAAACAGCATTGTGGG - Intergenic
1182991003 22:34767644-34767666 GTCTGAGGAAAACTGATTGTGGG - Intergenic
1184097599 22:42325048-42325070 GACTCAGGAAACCGCATGGGCGG + Intronic
1184831079 22:46988030-46988052 GTCTCAAGAAACCACTTTCTTGG + Intronic
1185311019 22:50154256-50154278 GTATCAGGAAAACACATTAGTGG + Intronic
949530727 3:4952547-4952569 TTCTCAGGAAACCAAATCATTGG - Intergenic
953095216 3:39768180-39768202 GTCTCCAGAATCCACTTTGTCGG + Intergenic
954303135 3:49711744-49711766 CTTTGTGGAAACCACATTGTGGG + Intronic
955466897 3:59246788-59246810 AGCTCAGGAAACTGCATTGTTGG - Intergenic
956410561 3:68974085-68974107 GTCTTAGGAAAACAGATTCTGGG - Intergenic
957783033 3:84844328-84844350 ATCTCAAGAAACCACTTTTTTGG - Intergenic
959726734 3:109551733-109551755 GTGACAGAAAACCACCTTGTAGG - Intergenic
962116595 3:132516090-132516112 GTGTCAGGAAATCAGATTTTTGG + Intronic
969096795 4:4738801-4738823 GCCTCTGGAAACCACATAATGGG - Intergenic
970061342 4:12037879-12037901 GTCTCAAAAAACCACAGTCTGGG - Intergenic
972400163 4:38694228-38694250 GTCTCAGGAAACCACATTGTAGG - Intronic
973062808 4:45749901-45749923 GTCTCAGAAAACAAAATTGCTGG + Intergenic
974234194 4:59160227-59160249 ATCTCAAGAAACCACTTTATTGG + Intergenic
974915911 4:68178311-68178333 GCCTCAGGAAACAACATTCATGG + Intergenic
976589206 4:86832262-86832284 GTCTCAGGTAAACACCTTGAAGG - Intronic
979307882 4:119168755-119168777 ATCTCAAGAAACCACTTTCTTGG - Intronic
979318480 4:119296478-119296500 GTCTGCGGAAAGCAGATTGTGGG - Intergenic
979354259 4:119684488-119684510 GTCTACGGCAGCCACATTGTTGG + Intergenic
980384171 4:132064082-132064104 GATTCAGGAAACCACTTTGCAGG - Intergenic
985188118 4:187340022-187340044 ATCTCAGGAAACCACTTTCTTGG + Intergenic
985933114 5:3074478-3074500 CTTTCAGGAAACCACACTCTAGG + Intergenic
987093768 5:14530401-14530423 GTCTCAGAAAGGCACAATGTGGG + Intronic
987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG + Intronic
989449740 5:41572709-41572731 CTCTCCAGAAACCACATTTTAGG + Intergenic
990177784 5:53126992-53127014 TACTCAGGCAACCACCTTGTGGG - Intergenic
990501424 5:56400085-56400107 TTCTCAGGAAACCTCATGGTGGG - Intergenic
990874698 5:60471312-60471334 ATCTCAGGAAACCACTTTCTTGG - Intronic
991214270 5:64144262-64144284 GGCTCATGAAACCAAATTATAGG + Intergenic
991270682 5:64775899-64775921 GTATCAGAAAACAACATTTTGGG + Intronic
994455723 5:100004852-100004874 GTCTCAGGAAACTACAATCATGG - Intergenic
997153551 5:131526496-131526518 GTATCAGGAAACAACTTAGTAGG - Intronic
1000464829 5:161562893-161562915 GGAACATGAAACCACATTGTAGG - Intronic
1001045818 5:168370831-168370853 GTCTAAGGAAGCGCCATTGTGGG + Intronic
1003121094 6:3319502-3319524 ATCTCCTGAAAGCACATTGTGGG - Intronic
1004869930 6:19894576-19894598 GCCTTAGGAAATCACTTTGTTGG - Intergenic
1005376857 6:25191674-25191696 GTGTCTGGAAACCACAATCTAGG + Intergenic
1005449299 6:25957531-25957553 ATATCAGGAAGCCACATTTTGGG + Intergenic
1007667753 6:43525618-43525640 CTCTCAGGAAAACACATAGTAGG - Intronic
1012227677 6:96723703-96723725 TTCTCAGGAACCCAAAATGTAGG + Intergenic
1014313115 6:119830251-119830273 CTCTCAGGAAGCCACATCCTGGG - Intergenic
1016609019 6:145967098-145967120 ATCTCAGGAAACCAGTTTCTTGG - Intergenic
1020849141 7:13327855-13327877 TGCCCAGGACACCACATTGTTGG - Intergenic
1022120917 7:27307299-27307321 GTCTCAGGAAAGGACATTACAGG - Intergenic
1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG + Intronic
1024923778 7:54590826-54590848 GGCTCAGGCAGCCACATTTTGGG + Intergenic
1028218883 7:88170495-88170517 GGCTCAGGAAATCAGATTGAAGG + Intronic
1028535217 7:91884030-91884052 GTCTCAGGTTAACACTTTGTTGG + Intergenic
1029983526 7:104901276-104901298 ATATCAGGAAAACACTTTGTTGG - Intronic
1032311312 7:130789968-130789990 GTCACAGGAAACCACAGTCTTGG - Intergenic
1035953067 8:4045193-4045215 CTCTGAGGAACCCACAATGTGGG + Intronic
1037938454 8:22930957-22930979 GTCTCAGGAAGCCACAGGTTTGG - Intronic
1038418103 8:27412372-27412394 GTCTGAGGAACCCACAGTGAAGG + Intronic
1042686580 8:71448329-71448351 CTCTCAAGAAACCACTTTCTTGG + Intronic
1043616456 8:82130886-82130908 CTCTCAAGAATCCCCATTGTAGG + Intergenic
1047283387 8:123465033-123465055 GTCTCAGGAAAAAAAAGTGTGGG + Intronic
1047828025 8:128599305-128599327 ATCTCAAGAAACCACTTTCTTGG - Intergenic
1049231233 8:141483842-141483864 ATCTCAGAAAACTATATTGTAGG - Intergenic
1055435495 9:76288238-76288260 TTCTCAGGAATCCCCATTCTTGG + Intronic
1057064775 9:92038568-92038590 CACTCAGGAAGCCACATTGCAGG - Intronic
1057935201 9:99232551-99232573 GGCTCAGGAAACAACAATCTAGG - Intergenic
1058977424 9:110137680-110137702 GTCTCAGGATACCACAGTCCTGG + Exonic
1061563271 9:131420209-131420231 GTTTGAGGAAACCACAGAGTGGG - Intronic
1187730289 X:22245771-22245793 GTCTCAGTAAACTGCATTATTGG + Intronic
1188348154 X:29093878-29093900 GTCCCAAGAAACCAAAGTGTAGG + Intronic
1193724128 X:85020449-85020471 GTCTCAGTAAAACACAATGCAGG + Intronic