ID: 972405310

View in Genome Browser
Species Human (GRCh38)
Location 4:38740568-38740590
Sequence TAACAGAATCCTGTCTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972405309_972405310 -10 Left 972405309 4:38740555-38740577 CCAGCTGTCAAGGTAACAGAATC No data
Right 972405310 4:38740568-38740590 TAACAGAATCCTGTCTCTAAAGG No data
972405308_972405310 -4 Left 972405308 4:38740549-38740571 CCAATGCCAGCTGTCAAGGTAAC No data
Right 972405310 4:38740568-38740590 TAACAGAATCCTGTCTCTAAAGG No data
972405306_972405310 0 Left 972405306 4:38740545-38740567 CCATCCAATGCCAGCTGTCAAGG No data
Right 972405310 4:38740568-38740590 TAACAGAATCCTGTCTCTAAAGG No data
972405305_972405310 29 Left 972405305 4:38740516-38740538 CCATGACTCAGAGGATCACAGCT No data
Right 972405310 4:38740568-38740590 TAACAGAATCCTGTCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972405310 Original CRISPR TAACAGAATCCTGTCTCTAA AGG Intergenic