ID: 972411375

View in Genome Browser
Species Human (GRCh38)
Location 4:38798739-38798761
Sequence AAAGTGAATTTTTAGTTGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972411375_972411376 25 Left 972411375 4:38798739-38798761 CCTATCAACTAAAAATTCACTTT 0: 1
1: 0
2: 1
3: 29
4: 423
Right 972411376 4:38798787-38798809 AAGTATTAACATGAAGATAATGG 0: 1
1: 0
2: 3
3: 36
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972411375 Original CRISPR AAAGTGAATTTTTAGTTGAT AGG (reversed) Exonic
907843593 1:58182050-58182072 AAATAGAATTCTTGGTTGATAGG + Intronic
908174483 1:61540941-61540963 ACCGTGAATTTTCAGTTAATAGG - Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
908848929 1:68354050-68354072 AAAATGAGTTTTTAGATGAAGGG - Intergenic
908970978 1:69830693-69830715 AACGTGAATTTTTTATTGAATGG - Intronic
908982568 1:69976528-69976550 ATAGTGAGTGTTTACTTGATTGG - Intronic
910193466 1:84618179-84618201 TAATTGAATCTTTATTTGATGGG - Intergenic
910906962 1:92191391-92191413 AAATTCAATGTTTAATTGATTGG - Intergenic
911245988 1:95518073-95518095 AAAGTAAATTAGTAGTTGCTTGG + Intergenic
911742113 1:101397842-101397864 TATTTGAATTTTTAGTTGGTTGG + Intergenic
912001258 1:104837485-104837507 AATGTGAATGATGAGTTGATGGG + Intergenic
912064597 1:105721019-105721041 AAAAGGAGTTTTTATTTGATTGG - Intergenic
913024457 1:114822837-114822859 AGAGTGAATTTTTAATTCCTTGG - Intergenic
914930896 1:151931933-151931955 CAAATGAATTTTGAGTTCATAGG + Intergenic
915677651 1:157546720-157546742 AAATAGAATTTTTACTTGAGTGG - Intronic
915714750 1:157934272-157934294 AAAGTGAATTCTCTGTTGCTAGG + Intergenic
916339774 1:163718988-163719010 AATGTGAATGTTTAGATAATAGG + Intergenic
916709830 1:167394632-167394654 GAACTGAATTTTTAATTTATTGG + Intronic
916796196 1:168169813-168169835 AAAGTGAATTTTCAGCTGTCTGG - Intergenic
917666578 1:177230848-177230870 AAAGAGAATTTTGAGTTCACTGG - Intronic
918752026 1:188284898-188284920 ACATTGAATTTTTAGCTAATAGG - Intergenic
918835392 1:189457102-189457124 ACTGTTAATTTTTTGTTGATAGG + Intergenic
919342761 1:196334831-196334853 GAATGGAATTTTTATTTGATAGG + Intronic
919357257 1:196538874-196538896 AAAGTTAATTTTCAATTGAGTGG - Intronic
920012990 1:202883601-202883623 ACACTGAATTCTTGGTTGATTGG - Intronic
920626283 1:207604541-207604563 AAACTGAATTATTCATTGATAGG - Intronic
920780737 1:208988743-208988765 AAAATGAATTTTAAATTTATTGG - Intergenic
921853615 1:219956801-219956823 AAATTGAATTATTACTGGATAGG - Intronic
921907826 1:220513804-220513826 TTTGTGAATTTTTAGTAGATGGG + Intergenic
923116368 1:230942442-230942464 AAAGTGAATTTTTGTTTTGTTGG - Intronic
923143677 1:231182987-231183009 ACAGTGAATTTTAAGTTGCCAGG - Intronic
923493088 1:234501605-234501627 ATAGTGAATTTTTTTTTGTTTGG - Intergenic
924146310 1:241078972-241078994 ACAGTTAATTTTTAGAAGATTGG - Intronic
924953065 1:248903164-248903186 AAAGTTAAGAATTAGTTGATAGG - Intergenic
1063195715 10:3741019-3741041 AATGTATATTTTTACTTGATTGG + Intergenic
1063976080 10:11416647-11416669 AAACTGTATTTTTTGTTTATAGG - Intergenic
1064250980 10:13706236-13706258 AAAGTGATTTCTTAGTTGTCAGG + Intronic
1065356392 10:24846061-24846083 AAAGTGTATTCCTTGTTGATGGG - Intergenic
1066514033 10:36135508-36135530 AAAGAAAATATTTAGTTCATTGG - Intergenic
1067133303 10:43585713-43585735 ATGGTGAATTCTTAGTTGTTTGG + Intergenic
1067322848 10:45238711-45238733 AAAGTGAATTTTTAAAGGGTGGG + Intergenic
1068056481 10:52017946-52017968 AAAGTGCAATTGTAGTTTATAGG - Intronic
1069260474 10:66387989-66388011 AATGTAAATTATGAGTTGATGGG + Intronic
1069658280 10:70106451-70106473 AAAGTCATTTTTTACTTGATTGG + Intronic
1071664079 10:87536651-87536673 ATAGTGAATTTTTTTTTGTTGGG + Intronic
1071914659 10:90279403-90279425 AAAGTGAATATTAAGATAATAGG - Intergenic
1072480071 10:95802554-95802576 AATGTGAATGATGAGTTGATGGG - Intronic
1072830384 10:98651582-98651604 AAAGTGAATTTGTAGGAGATTGG - Intronic
1073913430 10:108373876-108373898 ATATTGAATTTGTAGTTGACAGG + Intergenic
1074605583 10:114961334-114961356 AGACTTGATTTTTAGTTGATTGG + Intronic
1074949308 10:118313671-118313693 AAACTGAATTTGCATTTGATAGG - Intronic
1075110258 10:119573709-119573731 AAAGTTAATTTATATTTTATAGG - Exonic
1075900614 10:126040257-126040279 ACAGTGAATTTTTAGAGGACAGG + Intronic
1081045058 11:38263607-38263629 AAGGGGAAGTTTTATTTGATTGG + Intergenic
1081763091 11:45590870-45590892 AAGGGGAATTTTTGGCTGATGGG - Intergenic
1084921503 11:72474374-72474396 AAAATGAATTTTAAGTGCATTGG + Intergenic
1085438001 11:76527267-76527289 AAAGTAAATTAGTAGTTTATAGG - Intronic
1085847122 11:80078554-80078576 AATGTGAATGTTTCGGTGATTGG + Intergenic
1085948955 11:81306227-81306249 AAAGTGACTTACTAGTAGATAGG + Intergenic
1086442643 11:86844306-86844328 AATGTAAATGTTGAGTTGATGGG + Intronic
1086469602 11:87093856-87093878 AAACTGAATTTTTACTGGACAGG - Intronic
1086507988 11:87525998-87526020 AAAGAGAATTTCTAGTTCCTGGG + Intergenic
1086531038 11:87785282-87785304 AATGTGAATGACTAGTTGATGGG + Intergenic
1087192136 11:95266079-95266101 AAAGATAAGTATTAGTTGATGGG + Intergenic
1087307041 11:96500352-96500374 AAATTGAATATTTTGTTGTTTGG - Intronic
1087571429 11:99931971-99931993 AAAGTTAATTTACAGGTGATGGG - Intronic
1087658048 11:100950143-100950165 AAAGTTAATTTTTATTTCTTTGG + Intronic
1087985946 11:104679757-104679779 AAAGTCAATTTGTAGTTATTAGG + Intergenic
1089314434 11:117581918-117581940 GAAGTGAATTTTGAGGAGATAGG - Intronic
1090549378 11:127803052-127803074 AAAGTGAATTTTTAGGGAAAAGG + Intergenic
1091138127 11:133211295-133211317 AGAGTGGATTTTTAGGTGCTGGG - Intronic
1091199831 11:133768201-133768223 AAATTGAATTTATAATTTATAGG + Intergenic
1093191887 12:16084358-16084380 ATACTGAATTTTCGGTTGATAGG + Intergenic
1094824331 12:34256810-34256832 AAAGTGAAGTTTTACTGGCTGGG - Intergenic
1095372337 12:41483820-41483842 AAAGAGAATTTCTACTTGATTGG - Intronic
1097293887 12:57942724-57942746 AAAGTGTATTTTTTTTTGGTCGG + Intronic
1097759004 12:63438844-63438866 AAAATGAATTGTTAATTGTTGGG + Intergenic
1097987652 12:65801165-65801187 CAACTGAATTTTTAGTGGCTTGG - Intergenic
1099417983 12:82417243-82417265 AAAGTAAAATTTAGGTTGATAGG - Intronic
1099468394 12:83016145-83016167 AAAATGTGTTTTGAGTTGATTGG + Intronic
1099963229 12:89416936-89416958 TATGTGATTATTTAGTTGATAGG - Intergenic
1100696360 12:97098290-97098312 ATTGTGAATTTTAAGTTGTTAGG - Intergenic
1100856535 12:98762343-98762365 AAACTGAATCTGTAGTTGACTGG - Intronic
1100949782 12:99834070-99834092 AAATTAAATTTTTAGTTGGAGGG - Intronic
1100962238 12:99975323-99975345 ATAGTGAAGTTGTAATTGATTGG - Intronic
1100969350 12:100050965-100050987 AAAATGAATTCTTAGATGGTGGG - Intronic
1101887808 12:108682698-108682720 AAAGTGTATTTTTAAATGTTAGG - Intronic
1104258056 12:127157180-127157202 AAAGTAATTATTTACTTGATTGG - Intergenic
1105550110 13:21385990-21386012 ACAGTGAATTCTAAGTCGATAGG - Intronic
1105669406 13:22595490-22595512 AATGTGAACTTTTACTTGTTTGG + Intergenic
1106722139 13:32446061-32446083 AAAGAGAATAGTCAGTTGATTGG + Intronic
1107132874 13:36914974-36914996 AAAGTAAATCTGTATTTGATAGG + Intronic
1108450790 13:50560975-50560997 AAAGTTAAATTTTATTTTATAGG + Intronic
1108989331 13:56634813-56634835 AAAGTAAATTACTAGTTAATGGG + Intergenic
1109262677 13:60163239-60163261 AAAATGAACTTTTAGGTGACAGG - Intronic
1109267298 13:60216348-60216370 AAAGGGAATTATTAGGTAATGGG + Intergenic
1109508200 13:63334987-63335009 AAATTGTATTTTTGTTTGATAGG + Intergenic
1110770264 13:79334874-79334896 AAAGTTAATTGTTAATTAATGGG + Intronic
1111756787 13:92407044-92407066 AAGGTAAAATTTTAGTTTATGGG + Intronic
1111814562 13:93134460-93134482 AAAGTGCAGTTTTAGTGGAATGG + Intergenic
1111994255 13:95148156-95148178 AAAATCAATTTTTAGCTGTTAGG + Intronic
1112131743 13:96532195-96532217 AAGGGGAATTCTTATTTGATGGG + Intronic
1112134356 13:96559883-96559905 AAAATGTATTTTTAGTGGAGTGG + Intronic
1112220222 13:97481406-97481428 AAAGTGACCTTTTGGTTCATAGG - Intergenic
1112487144 13:99830202-99830224 AAAATGCATTTTTAGATGACTGG - Intronic
1113756240 13:112812996-112813018 AAATTGAATTTTTAATGTATCGG + Intronic
1115493160 14:33978410-33978432 GAAGCCAATTTTGAGTTGATGGG - Intronic
1115533776 14:34353299-34353321 AAAGTGTATTTTTGATTGACAGG + Intronic
1116141451 14:41000483-41000505 AAATTGTATTTTTAGATTATAGG - Intergenic
1116286729 14:42983379-42983401 AAAGTAAATGTTTTGTTGACAGG + Intergenic
1117700385 14:58406775-58406797 AAAGTGAGTTTTAGGATGATTGG - Intronic
1117877115 14:60264192-60264214 ATAGGGAATTCTTGGTTGATAGG + Intronic
1118809775 14:69264666-69264688 AAAGTGATTTTGTATTTAATTGG + Intronic
1118930755 14:70238125-70238147 AAAGAGTATTTTTGGTTGAAGGG - Intergenic
1120602893 14:86533932-86533954 AAATTGCATTTTTGGTTGGTGGG + Intergenic
1120702588 14:87714223-87714245 AAAGAGACATTTTAGTTGTTGGG + Intergenic
1123185469 14:106512468-106512490 AATCTGAATTTTTTGTTCATAGG + Intergenic
1123388931 15:19849601-19849623 AAAGTATATTTTTATTTGAAAGG - Intergenic
1124791130 15:32728305-32728327 AAAGTAATTTTTTTGTTGTTGGG + Intronic
1125809144 15:42521797-42521819 AAAGTGAATTTGTTCTTGATGGG + Intronic
1126638315 15:50800987-50801009 AAACTGAGTTTTTAATAGATAGG + Intergenic
1127070089 15:55280605-55280627 AATGTAAATTATGAGTTGATGGG - Intronic
1127112488 15:55689530-55689552 AATGTAAATTATGAGTTGATGGG + Intronic
1127716612 15:61654940-61654962 AAAGTGATTATTTAGGTAATAGG + Intergenic
1130437546 15:83916521-83916543 AAAGTAAATTTTTAATTTCTTGG + Intronic
1130449071 15:84032647-84032669 AAAGTTAATCTTTACTTGATGGG - Intronic
1131652596 15:94417431-94417453 AAATTGAATTTGTAGTTGCTGGG + Intronic
1133409107 16:5553176-5553198 AATGTGAATGATGAGTTGATGGG + Intergenic
1134450930 16:14362942-14362964 AAAGTGAAGTATTTGTTGCTGGG - Intergenic
1135243669 16:20835021-20835043 ATAGTGAATTTTAATTTGTTGGG + Intronic
1137223133 16:46475448-46475470 AAAGTATACTTTTAGTTGTTAGG + Intergenic
1137370689 16:47903150-47903172 AATGTAAATTATGAGTTGATGGG + Intergenic
1138795023 16:59957545-59957567 AATGTAAATTATGAGTTGATGGG - Intergenic
1139222480 16:65197953-65197975 GAAGGGAATTTTCAGTAGATGGG - Intergenic
1139294297 16:65886765-65886787 AATTTGTATTTTTAGTAGATAGG - Intergenic
1139368939 16:66452917-66452939 AAAGACAATTTTTAGTTGGGGGG - Intronic
1140164570 16:72536472-72536494 AATGTTAATTTTTATTTGGTTGG + Intergenic
1140453568 16:75090894-75090916 AAATTAAATTTTTATTTAATTGG - Intronic
1140662596 16:77201817-77201839 AAATTAAATTATAAGTTGATAGG + Exonic
1141345743 16:83243820-83243842 AAAGTGAAATTTTACTGGAATGG + Intronic
1144062322 17:11594373-11594395 AAATGGACTTTTTAGTTGATTGG - Intergenic
1144104165 17:11971253-11971275 CAAGTGCATTACTAGTTGATGGG - Intergenic
1144449134 17:15360700-15360722 AAAGTAAATTTTGAGTTAATGGG + Intergenic
1145282825 17:21480195-21480217 AGAGTGAATTTTTGGATGACGGG + Intergenic
1145847027 17:28048978-28049000 CCAGTGAATTATTTGTTGATTGG + Intronic
1148975047 17:51520258-51520280 AATGTAAATGTCTAGTTGATGGG - Intergenic
1149892456 17:60402073-60402095 AAAGTGAAATTCTAGTTAATAGG + Intronic
1150973968 17:70062694-70062716 AAAAAAAATTTTTAGTAGATAGG + Intronic
1152185537 17:78854446-78854468 AAGGTGAATTCTCAGATGATAGG - Exonic
1153248010 18:3092582-3092604 AAAGATAAGTTTTAGTTGCTAGG + Intronic
1153292076 18:3511229-3511251 AAAGTGAGTTTTTAGTTCTCCGG - Intronic
1154532951 18:15366516-15366538 AAAGTATATTTTTATTTGAAAGG + Intergenic
1156620775 18:38848941-38848963 AAATAAAATTTTTAATTGATGGG + Intergenic
1157419962 18:47538915-47538937 AATGTGAATGATTAGTTGATGGG - Intergenic
1157612678 18:48968250-48968272 AGAGAGAATGTTCAGTTGATAGG - Intergenic
1157770761 18:50343868-50343890 AAAGTGATTTTTTATATAATTGG + Intergenic
1157935770 18:51871442-51871464 AACATGTATTTGTAGTTGATAGG + Intergenic
1158056831 18:53291250-53291272 AAAATGAAATATTAGTTTATAGG - Intronic
1158197372 18:54903875-54903897 AAAGTTAACTTTTGGATGATAGG - Exonic
1158838660 18:61359490-61359512 AAAGTGAATTCTTAGAAGATTGG - Intronic
1159236096 18:65674217-65674239 CAAGTGAAGTTTTATTAGATAGG - Intergenic
1159728785 18:71998350-71998372 AAAGTGGATTTCTAGTTTAGAGG + Intergenic
1159835687 18:73332406-73332428 AAAATAAGTTTTTATTTGATAGG - Intergenic
1160008975 18:75089339-75089361 TAGGTGAAATTCTAGTTGATGGG - Intergenic
1160237133 18:77094644-77094666 AAAGTTAATTTTGAGTTCAGAGG - Intronic
1163456159 19:17406815-17406837 TAAGTGATTTTTTTGTTTATTGG - Intronic
1164195646 19:22955559-22955581 AATGTAAATGATTAGTTGATAGG + Intergenic
1167391512 19:49198227-49198249 AAAGTGACTTTTGAGATGAAAGG + Intronic
924995212 2:354402-354424 AAAATGAAGTTTTGGTTGCTGGG + Intergenic
925866437 2:8232055-8232077 AACGTGTATTTTTAGTTGTTGGG - Intergenic
926288824 2:11512376-11512398 TAAGTGAATTTTTACTTAATAGG - Intergenic
927304457 2:21554692-21554714 AAAGTGCATATTCAGCTGATTGG - Intergenic
927336634 2:21932078-21932100 AATGTGAATGATGAGTTGATGGG + Intergenic
927825305 2:26304852-26304874 CAAGTAAATTTTTGGTTGATGGG - Intergenic
928556401 2:32430774-32430796 GAAGTGAAGTTTTAATTCATGGG - Intronic
930413909 2:51065017-51065039 AAAGTGAGTTTTTAGAAAATAGG - Intergenic
930676501 2:54206389-54206411 AAAATAAATTTTAAGTGGATAGG - Intronic
931326724 2:61233463-61233485 AAAAAAAATTTTCAGTTGATTGG - Intronic
931382357 2:61765260-61765282 AGAGGGAATTTTTAGATGAGAGG + Intergenic
931545237 2:63376413-63376435 AATGTGAATTTTTTGTTCATTGG - Intronic
932388133 2:71357530-71357552 AAGGTGAATTTTTAGTTGGATGG + Intronic
933607728 2:84401470-84401492 AAAGTCAATGTTCACTTGATGGG - Intergenic
933994371 2:87656925-87656947 AAACTCAATATTTAGATGATTGG - Intergenic
935253079 2:101282724-101282746 AAAGTGACTTATTAGATGAGGGG + Intronic
935933765 2:108158692-108158714 AAATGAAATTTTTATTTGATGGG + Intergenic
936277389 2:111112044-111112066 AAAGTGATTTTGTTGTTGTTTGG + Intronic
936299487 2:111293988-111294010 AAACTCAATATTTAGATGATTGG + Intergenic
937055558 2:118932754-118932776 ATATTGAATTCTTAGTTGACAGG + Intergenic
937410202 2:121668252-121668274 AAAGTGACTTTTTACTTCACTGG - Intergenic
937446026 2:121958595-121958617 AAACTGAATTTTTACTTTTTTGG + Intergenic
937694321 2:124790665-124790687 AAAGTTCATATTTAGTTCATTGG + Intronic
937813677 2:126227143-126227165 AAAATTAATTTTTAGTTAAATGG + Intergenic
938014271 2:127854620-127854642 AAACTGTATTTTTATTTGAAAGG + Intronic
939814644 2:146878783-146878805 CATATGCATTTTTAGTTGATGGG - Intergenic
940104011 2:150077359-150077381 AATGTAAATTATGAGTTGATGGG - Intergenic
940251149 2:151678301-151678323 CAAGTGAATTGTTAATTGTTTGG - Intronic
940350290 2:152677581-152677603 AAAGTGATTTTTTATTTTTTAGG - Intronic
940489675 2:154342497-154342519 AAAACGAATTCTTAGTTCATAGG - Intronic
941508882 2:166381078-166381100 AATGTGAATTTTACGTTGTTAGG - Intergenic
941554641 2:166961723-166961745 AAATATAATTTTAAGTTGATAGG - Intronic
941777996 2:169413672-169413694 AAAGAAAGTTTTTACTTGATTGG + Intergenic
943276367 2:185872213-185872235 AAATTAAATTTTTAGTAGAATGG + Intergenic
943290098 2:186059568-186059590 AAAGTAATTTTTTAAATGATTGG + Intergenic
943509484 2:188806319-188806341 AAAGTGAAGTTAAGGTTGATAGG - Intergenic
944853277 2:203742270-203742292 AAAATCCATTTTTAGTTCATGGG + Intergenic
944961402 2:204878594-204878616 AAATTGCATTTTTATTTGAAGGG - Intronic
945613668 2:212039057-212039079 AAAATAAATTTTTATTTCATTGG - Intronic
945748548 2:213750560-213750582 AACATGAATTTTTAATCGATTGG - Intronic
946083134 2:217143895-217143917 AAAGGGAATTTTTAATCTATAGG + Intergenic
946479359 2:220039294-220039316 AAAGTGAATTTAGAATTGATGGG + Intergenic
947084852 2:226439321-226439343 AAAGTGAATTTTTACTGGGTAGG - Intergenic
947801537 2:232931374-232931396 AAATTGGATATTTAGTTGAGTGG + Intronic
1169877556 20:10314560-10314582 AAAGTGAATTTTTAGTGGAGTGG - Intergenic
1170215535 20:13886899-13886921 AAAGTGCAATTTTTGTTTATTGG + Intronic
1170513414 20:17103034-17103056 ACTGTGAATTTTTGGCTGATTGG + Intergenic
1170687500 20:18582610-18582632 AAAGGGAATTGTTGTTTGATGGG - Intronic
1171153113 20:22845260-22845282 AAATCAAATTTTTAGTGGATAGG - Intergenic
1171772367 20:29333139-29333161 AAAGTGTATATTCTGTTGATTGG - Intergenic
1172488291 20:35313562-35313584 AAACTTAATTTCTAGTTTATTGG - Intronic
1173033451 20:39384084-39384106 AAAATTTATTTTTAGTTGACAGG - Intergenic
1176340642 21:5691844-5691866 AATGTAAATGTTGAGTTGATGGG + Intergenic
1176472896 21:7123997-7124019 AATGTAAATGTTGAGTTGATGGG + Intergenic
1176504185 21:7632612-7632634 AATGTAAATGTTGAGTTGATGGG - Intergenic
1176885200 21:14246898-14246920 AAGTTGCATTTTTTGTTGATGGG - Intergenic
1176906271 21:14505155-14505177 AAATTGTATTTTTGTTTGATAGG - Intronic
1177359762 21:20052854-20052876 AAAATGAATTTTTAATTGTAGGG + Intergenic
1177962390 21:27683510-27683532 AAAGGGAATTTTTAAGTGAATGG - Intergenic
1179989330 21:44938950-44938972 AAAGTGCATTTTTTGTGGGTGGG + Intronic
1181896465 22:26112377-26112399 AAATTAAATTATTAGTTAATTGG + Intergenic
1183239002 22:36641871-36641893 GAAATGAATTTTTATTTCATTGG + Intronic
1183896380 22:40972746-40972768 AAAGTGAAATGTTTGTTCATCGG + Exonic
1185102951 22:48851333-48851355 CAGGTGAGTGTTTAGTTGATGGG + Intergenic
1185102987 22:48851543-48851565 CAGGTGAGTGTTTAGTTGATGGG + Intergenic
1203239905 22_KI270733v1_random:6302-6324 AATGTAAATGTTGAGTTGATGGG + Intergenic
1203302827 22_KI270736v1_random:88960-88982 AAAAGGAATTTGTAGTTGAATGG + Intergenic
949714240 3:6910140-6910162 AAAATTAATATTTAGTAGATAGG + Intronic
950114285 3:10440453-10440475 AAAATGAATCTGTAGTTCATGGG + Intronic
951373677 3:21886722-21886744 AAAGAGAATTATAAGCTGATGGG + Intronic
951979511 3:28550089-28550111 CAAGTGAATTTTAAGCTGTTGGG + Intergenic
953270803 3:41442145-41442167 AAAGTGGACTGTTAGCTGATGGG + Intronic
955361114 3:58275740-58275762 AACGTGAATGGTGAGTTGATGGG - Intronic
955942763 3:64162203-64162225 AAATGTAATTTTTAATTGATAGG - Intronic
956987483 3:74718830-74718852 AAAGTAAATGTTTAGTTGCCGGG - Intergenic
957508490 3:81156211-81156233 AATGTGAAGTATTAGTTGAAAGG - Intergenic
957971876 3:87392326-87392348 AAATTGCATTTTTGTTTGATAGG - Intergenic
958109676 3:89124417-89124439 AAAGTGAATTGTTACTTAATTGG - Intronic
958447667 3:94235261-94235283 AATGTAAATGTTGAGTTGATGGG - Intergenic
958564200 3:95786857-95786879 ATAGTGAAGTTTTAGTTGAGGGG + Intergenic
958783322 3:98569253-98569275 AATGTAAATTATAAGTTGATGGG - Intronic
959219048 3:103491862-103491884 AAAGTGTATTTTTACTTCTTGGG + Intergenic
959613667 3:108322956-108322978 AAAATGAATCTGTAGTTAATGGG - Intronic
960104679 3:113781753-113781775 CAAGTGAATTTTTTCTTCATTGG + Intronic
962185175 3:133250853-133250875 AAAGTAAATTTAGAGTTGAAAGG - Intronic
963799878 3:149665089-149665111 AAAGTGTATTTTTATTTTCTAGG - Intronic
964357882 3:155866974-155866996 AAAGCTAATTTTTTGTTAATGGG + Intergenic
966649971 3:182289550-182289572 AAAGTTAATATTTAGTTACTTGG - Intergenic
969069240 4:4520448-4520470 AAAGTGCATTTTTATGTGAAAGG - Intronic
969896887 4:10313650-10313672 TCAGTGAATATTTAGTTGAAAGG - Intergenic
969913054 4:10462407-10462429 AAGGTGATTTTTGAGTTGAGAGG - Intergenic
971745895 4:30580273-30580295 AAAGTTAATTTTTGGTAGTTTGG - Intergenic
972411375 4:38798739-38798761 AAAGTGAATTTTTAGTTGATAGG - Exonic
973825750 4:54705344-54705366 AAAGTAATTTTTTAGTGGCTGGG + Intronic
974214335 4:58826091-58826113 TAAGTCAATATTTACTTGATTGG - Intergenic
974627019 4:64439114-64439136 AAAATCAAATTTTAGTTGAATGG - Intergenic
974874458 4:67686130-67686152 AGGGTGAATTTTTAATCGATAGG - Intronic
975446396 4:74470503-74470525 CAACTGAATTCTTGGTTGATAGG - Intergenic
975503769 4:75116323-75116345 AATGTAAATTATGAGTTGATGGG + Intergenic
975537323 4:75464935-75464957 AAAGTGAATTTGTGGTTGCCCGG - Intergenic
975626692 4:76356920-76356942 AAATTGAATTGTTAGGTGAGGGG - Intronic
975802633 4:78077387-78077409 AAATTGAATTCTTAGTTGTTTGG - Intronic
975892670 4:79048228-79048250 AAAGTGTATTTTTAGTACTTTGG + Intergenic
977300765 4:95264727-95264749 AAAGTGAAGTTTGAGTAGAGTGG - Intronic
977490958 4:97710732-97710754 GAAGTTACTTTTAAGTTGATGGG - Intronic
977775326 4:100912584-100912606 AAAATCTATTTTTAGTTCATAGG - Intergenic
979204112 4:118014285-118014307 AAACAGTATTTTTAATTGATTGG + Intergenic
980299602 4:130972016-130972038 TAACTGAATTTTAAGTGGATGGG + Intergenic
980545179 4:134252023-134252045 AAGGTGAATTGTTAGGTTATTGG + Intergenic
980634710 4:135485924-135485946 AAAATAAATTATTAGTTGCTTGG - Intergenic
981668027 4:147253042-147253064 AAATCAAATTTTTGGTTGATAGG - Intergenic
982039713 4:151384542-151384564 AAACTGATTTTTGATTTGATAGG + Intergenic
982486527 4:155972794-155972816 ATAATGAATTTTTCATTGATGGG - Intergenic
982678996 4:158407705-158407727 AATGTGAATTTATATATGATAGG - Intronic
982841976 4:160200136-160200158 AAAATGACTTCTTAGTTCATGGG + Intergenic
983334081 4:166370594-166370616 AATGTGAATTATGAGTTAATGGG - Intergenic
983562456 4:169114780-169114802 AAAGTTAATATTTAATTGTTCGG - Intronic
983748654 4:171234657-171234679 AAAGAGAATTATTTGTTGAGTGG + Intergenic
983902354 4:173148881-173148903 AAAGTGAAGATTTACTTGATAGG - Intergenic
984005304 4:174298580-174298602 AAAATGTATTTTTAGTTTTTAGG + Intronic
984225007 4:177023906-177023928 AGAAAGAATTTTTTGTTGATTGG + Intergenic
984431618 4:179657648-179657670 AAAGTTAATATTTAGTTTATAGG + Intergenic
985082066 4:186276463-186276485 AGAGTAAATTTTTAGTTACTTGG - Intronic
985233305 4:187845464-187845486 AAAGTCAATGTTAACTTGATGGG - Intergenic
986372722 5:7096936-7096958 AAATAGAATTTTTAGTTACTGGG - Intergenic
986604968 5:9513651-9513673 TCAGTGAATCTTTAGTTGCTTGG - Intronic
986733949 5:10654370-10654392 ATAGTGAATTTCAAGTTGACAGG + Intergenic
987907715 5:24099149-24099171 AAATTGAATTTATAATGGATTGG - Intronic
987950991 5:24675754-24675776 CAAATGCATTTTTAGTTTATTGG - Intergenic
988628826 5:32907226-32907248 AATGTGAATGATGAGTTGATGGG - Intergenic
989018208 5:36966363-36966385 AAAGCTAATTTCTACTTGATAGG - Intronic
990451519 5:55935427-55935449 ATATTGAATTTTGAGTTGAAAGG + Exonic
990626432 5:57617626-57617648 AAAGGCAATTTGTAGATGATTGG - Intergenic
990724098 5:58734364-58734386 GAACTGACCTTTTAGTTGATAGG - Intronic
990769990 5:59232550-59232572 AAAGGGAATTCTTAGTTGGTGGG + Intronic
991518510 5:67467052-67467074 AAATTGAATTATTACTTTATTGG + Intergenic
992119698 5:73579295-73579317 AAACTGAATTTTTACTTTGTAGG + Exonic
992226437 5:74623629-74623651 AAAATGGATTTTGAGTTAATGGG - Intergenic
992359339 5:76020457-76020479 AACCTGACTTTTTAGTTCATAGG + Intergenic
992475849 5:77100941-77100963 AAAAAAAATTTTTAGATGATTGG - Intergenic
992477158 5:77114556-77114578 AATGTAAATTATGAGTTGATGGG + Intergenic
993621369 5:90172052-90172074 TAAGTGAAATTGTAGTAGATTGG - Intergenic
994163366 5:96581932-96581954 TTAGTCAATTATTAGTTGATGGG - Intronic
994227274 5:97267392-97267414 AAAGGCAATCTCTAGTTGATAGG - Intergenic
994262188 5:97672920-97672942 AAACTGAATTTTTGATTTATGGG + Intergenic
994341460 5:98633606-98633628 AAATTGATTTTTTAGTGAATTGG - Intergenic
994689701 5:103001368-103001390 AATGTGAAATTTTATTAGATAGG - Intronic
994766831 5:103928950-103928972 AAAGTTAAGTTTTAGTTATTTGG + Intergenic
994864210 5:105244637-105244659 AAATTCAATTTTGAGTTCATTGG - Intergenic
994887314 5:105581516-105581538 AGAATGAATTTTTTGGTGATGGG + Intergenic
995553192 5:113300548-113300570 AAAGTGAATTTTGAGGGCATAGG + Intronic
995797344 5:115956060-115956082 AAAGTGAAATCGTAGTTAATTGG + Intergenic
996418069 5:123231265-123231287 AAAATGAATTTTTTGTTGAATGG - Intergenic
996453422 5:123654171-123654193 AAAGTTATTTTTTAGTCGACTGG + Intergenic
996761815 5:126993643-126993665 AAAGTGAATGTTTGGCTGCTTGG - Intronic
996916903 5:128722942-128722964 CAAGTGAATTTTTAAAAGATGGG - Intronic
998804486 5:145905124-145905146 AAAGTAATTTATTGGTTGATTGG - Intergenic
999569436 5:152901986-152902008 AAAGTTAAATATTTGTTGATTGG + Intergenic
1000281725 5:159788120-159788142 AAAATGGATTGTAAGTTGATTGG - Intergenic
1000588848 5:163133769-163133791 AAAAAAAATTTTCAGTTGATGGG + Intergenic
1003165312 6:3672286-3672308 AATGTAAATGATTAGTTGATGGG - Intergenic
1003277885 6:4667791-4667813 AAAGTGAACTTTCAGCTGACAGG + Intergenic
1003297781 6:4848661-4848683 ACAGTGTATTTTTAGTTGTGTGG + Intronic
1004547289 6:16610273-16610295 AGAGTGAGTTTTTGGTTGGTTGG - Intronic
1004653606 6:17635940-17635962 AAAATTAATTTTAAGTTGAAGGG - Intronic
1004740182 6:18452419-18452441 AAAGGGAATTTTTAGGGGAGAGG + Intronic
1005404621 6:25473324-25473346 CATGTGAATTTTTGGTTGCTTGG - Intronic
1007013828 6:38442836-38442858 AATTTGTATTTTTAGTAGATAGG + Intronic
1008078138 6:47167352-47167374 TATGTGATTTTTTAGGTGATTGG - Intergenic
1008284667 6:49633652-49633674 AAAGTGAAATTTTACATGAAAGG - Intronic
1008322804 6:50138195-50138217 ACAGTTAATTTATAGATGATAGG + Intergenic
1008408341 6:51144019-51144041 AAAGTAAATGATGAGTTGATGGG + Intergenic
1008795744 6:55300398-55300420 AAATTGATTTTTTATTGGATAGG + Intergenic
1009371072 6:62904708-62904730 AAACTTAAATTTTAGATGATGGG - Intergenic
1009777403 6:68222422-68222444 AAAATGAATTTTTAATAAATTGG - Intergenic
1011143947 6:84191263-84191285 GAAGTGAATTTTAGGTTGAGGGG - Intronic
1011870966 6:91892186-91892208 AAATTGGAATTTTTGTTGATTGG - Intergenic
1012677274 6:102132496-102132518 AGAGGGAATATTTAGTTGAGAGG - Intergenic
1012706461 6:102538201-102538223 AAAGTGAATTTGGAACTGATTGG + Intergenic
1012832658 6:104225113-104225135 AAAATGTATTTTTAGCTGCTGGG - Intergenic
1013281662 6:108643462-108643484 AAAGTGAATGTGAAGTTAATGGG + Intronic
1013872365 6:114780768-114780790 AAGTTAAATTTTGAGTTGATAGG - Intergenic
1013911068 6:115277051-115277073 ACAGTGAATTTCTGGTTGGTGGG - Intergenic
1014152762 6:118077496-118077518 AAAATGAATATTTGATTGATAGG - Intronic
1014233562 6:118930817-118930839 AAAGTGATTTTTTAGTAGGATGG - Intronic
1014382994 6:120767438-120767460 ACAGTGAAGTTTTAATTAATTGG - Intergenic
1014385612 6:120798214-120798236 AAAATGAGTTTTCAGTTGTTTGG + Intergenic
1014685352 6:124491846-124491868 AAAGTAACTTTTTAGTTTACTGG - Intronic
1014739363 6:125129016-125129038 AAAGTGGATCTTTAGTTGTCTGG + Intronic
1016886086 6:148960565-148960587 AAAGGGATTTTTTTGTTGAATGG + Intronic
1017190302 6:151646760-151646782 AAATTGCATTTTTATTTTATAGG + Intergenic
1017308310 6:152947008-152947030 GATGTGATTTATTAGTTGATAGG + Intergenic
1017397661 6:154021456-154021478 AAACTGATTTTTAAGTTTATAGG - Intronic
1018665813 6:166136723-166136745 AAATTGTATTTTTATTTTATAGG - Intergenic
1018780403 6:167058500-167058522 GAATTGCATTTTTAGTTGACAGG + Intergenic
1019874751 7:3799863-3799885 AAAGTGAATACTTAGTTCATGGG + Intronic
1020182434 7:5932814-5932836 AAAATGAATTTTAAATTGACTGG - Exonic
1020300477 7:6791943-6791965 AAAATGAATTTTAAATTGACTGG + Exonic
1021473912 7:21038767-21038789 AAATTGTATTTTTATTTTATAGG + Intergenic
1021525482 7:21581871-21581893 AAAGTGAAATATTAGTATATTGG - Intronic
1021830777 7:24606370-24606392 AAAATGATTTTATAGGTGATAGG + Intronic
1021846678 7:24769843-24769865 ATAGTGAATTTTTAATTCCTGGG - Intergenic
1021957854 7:25844067-25844089 TAAGTCAATTTTTAGATGAAGGG + Intergenic
1022251529 7:28613201-28613223 AAAATATATTTTTAGTTGTTTGG - Intronic
1023342623 7:39237771-39237793 AAAGTGAGTTTTCATTTGAGAGG - Intronic
1023650663 7:42365539-42365561 AATGTAAATGTTGAGTTGATGGG - Intergenic
1024433139 7:49314374-49314396 AATTTGAATTTTCAGTTGATAGG - Intergenic
1024680183 7:51678276-51678298 AATGTAAATGATTAGTTGATGGG + Intergenic
1024954995 7:54908758-54908780 AAAATGTATTGTTAGTTGTTAGG - Intergenic
1026099608 7:67373769-67373791 AATGTAAATGTTGAGTTGATGGG - Intergenic
1027470460 7:78567149-78567171 AAAGTAAATTCATAGTTGATAGG + Intronic
1027555983 7:79665354-79665376 AAAGGGAATTTTTGGCTGAGGGG - Intergenic
1027759743 7:82262518-82262540 AAAGTGAATTTTTTTTTAGTTGG - Intronic
1028437234 7:90818076-90818098 GAAGTGATTTGCTAGTTGATTGG + Intronic
1028551439 7:92071547-92071569 AAAGTAGATTTTTAGTTTTTTGG - Intronic
1029809124 7:103029272-103029294 AAAGTGAATTTTTCTTTGCACGG + Intronic
1030972091 7:116072092-116072114 TAAGTTAATTTTTATTTTATGGG + Intronic
1031283174 7:119831762-119831784 AAAGTGAATATTTGGTACATTGG + Intergenic
1031326990 7:120413698-120413720 AAAAAGATTTTGTAGTTGATTGG + Intronic
1033400633 7:141020615-141020637 AATATGAATTTTTAATTGCTTGG - Intergenic
1033810196 7:145002846-145002868 AAAGTGGATTATTAATTAATTGG - Intergenic
1036121835 8:6026299-6026321 ATAAGGAATTTTTAGTAGATGGG + Intergenic
1036539221 8:9687604-9687626 GAAATGAATTTTTAGTAGAAGGG + Intronic
1036714783 8:11110725-11110747 AATGAGAATTTGTATTTGATAGG - Intronic
1037082039 8:14799342-14799364 AAAGTGAATCTTTATTTAAAGGG - Intronic
1038202238 8:25423955-25423977 CAAGTTAATTTTCATTTGATGGG + Exonic
1039444121 8:37617114-37617136 AAAGTGAATTTGTTGTTCAAAGG - Intergenic
1039450364 8:37669133-37669155 AAAGTAAATTGTAAGATGATGGG + Intergenic
1039795597 8:40910444-40910466 ATAGTGATTTTTTATTTGTTAGG + Intergenic
1041489402 8:58414895-58414917 AAAGAAAATTGTTATTTGATTGG + Intronic
1041814044 8:61946956-61946978 AAAGAGAAATATTAGTTTATAGG + Intergenic
1042458822 8:69038395-69038417 AAAGTATTTCTTTAGTTGATTGG + Intergenic
1042605301 8:70540111-70540133 AATGTGAATATTCAGTTAATAGG - Intergenic
1042814719 8:72865832-72865854 AAAGTGAAGTTAGAGTGGATGGG - Intronic
1043800310 8:84601428-84601450 AAAGTGGATGTTTAGTTTCTAGG - Intronic
1043854561 8:85249899-85249921 AAAGGGAACTGTTAGCTGATTGG + Intronic
1044403962 8:91805478-91805500 AAAGGGAATTTTTAATGGAAAGG + Intergenic
1044771423 8:95639373-95639395 AATGTGAATTTTTATTTTGTTGG - Intergenic
1045919825 8:107516616-107516638 ACTGTGAACTTTTAGATGATAGG + Intergenic
1045993878 8:108340675-108340697 AAAGTGAAATTAGACTTGATAGG + Intronic
1046205311 8:110986688-110986710 AAAGTGAAATGGTAGTTGCTGGG - Intergenic
1046210786 8:111072319-111072341 AAAGTGAATTTTAATGTGAGGGG + Intergenic
1046356693 8:113095437-113095459 AAAGTAATTTTGTAGGTGATAGG - Intronic
1046711007 8:117511554-117511576 AAAGTTAATTTTTACATGAATGG - Intergenic
1046986685 8:120396792-120396814 AAAGTGTATTTGTAGGTGTTGGG + Intronic
1047044059 8:121032047-121032069 AAAGACAATTTTTGGATGATGGG + Intergenic
1048765738 8:137842543-137842565 AAAATGAATTTAGAGTTGCTTGG - Intergenic
1049459572 8:142718732-142718754 ATTGTGACTTTTTAGTTGTTCGG - Intergenic
1050403174 9:5278875-5278897 AAAGTGAATGCTTCGATGATTGG - Intergenic
1052184003 9:25567355-25567377 AAAGTGAGTCCTTACTTGATAGG + Intergenic
1052246103 9:26337219-26337241 CAACTGAATTGTTAGTTGCTGGG + Intergenic
1052532041 9:29698426-29698448 TAAGATAATTTTTATTTGATGGG + Intergenic
1055900814 9:81234595-81234617 ATTGTGAATTTTATGTTGATTGG + Intergenic
1056945247 9:90989520-90989542 AAAGTGGAGTTTTATCTGATTGG - Intergenic
1057093321 9:92280822-92280844 AAACTGTATCTTTAGTTGCTTGG - Exonic
1058049086 9:100388565-100388587 AAAGAGAAGTTTTAGTTAACCGG - Intergenic
1058264840 9:102886065-102886087 ACATTGCATTTTTAGTTGAAAGG - Intergenic
1058877823 9:109259472-109259494 TGAGTGAAGTGTTAGTTGATGGG - Intronic
1058938366 9:109790365-109790387 AAAGTGAATACTTAGATGACTGG - Intronic
1059584738 9:115593775-115593797 AAAGTAAATTTTTAATTCACCGG - Intergenic
1060578739 9:124723762-124723784 AAAATGTATTTTTATTTTATTGG - Intronic
1060717793 9:125950390-125950412 AAACTGAATTTCTATTTGTTCGG + Intronic
1061267541 9:129515692-129515714 AAATTGAATATTCATTTGATGGG - Intergenic
1203422425 Un_GL000195v1:6149-6171 AATGTAAATGTTGAGTTGATGGG - Intergenic
1188172251 X:26941975-26941997 AAAGTAAATATTTATTTGAATGG + Intergenic
1188391548 X:29627121-29627143 AAAGTGAATGTCTAGTTTGTTGG + Intronic
1188513743 X:30963444-30963466 AAAGTGAATTTTAAGTGGGAAGG - Intronic
1189675290 X:43455179-43455201 AGAGTGAATTTTTAGATCATAGG + Intergenic
1191682151 X:63852109-63852131 AAAGTTTATTTTTAGCAGATGGG + Intergenic
1191799546 X:65062696-65062718 AAAGTCAATTGTGACTTGATGGG + Intergenic
1194156767 X:90399796-90399818 AGAGTAAAGTTCTAGTTGATAGG - Intergenic
1195049874 X:101087348-101087370 AGAGGGAATGTTTAGTTTATTGG - Intronic
1196289462 X:113922296-113922318 ATGTTGTATTTTTAGTTGATTGG + Intergenic
1197113642 X:122805354-122805376 AATGTAAATGTTGAGTTGATGGG + Intergenic
1197846872 X:130812437-130812459 AAAGTTTATTCTTAGTTGCTAGG - Intronic
1198088645 X:133305691-133305713 AAAATGAATTTTTAGCTGGAAGG - Intronic
1198149555 X:133894948-133894970 CAAGTGCATTTTTAGCTAATTGG + Intronic
1198293142 X:135257908-135257930 AATGTGAATGATGAGTTGATGGG - Intronic
1198600437 X:138279106-138279128 AAAGTAAATGATGAGTTGATGGG - Intergenic
1199443890 X:147899038-147899060 TAAGTGAACTTTTACTTGAAGGG - Intergenic
1199938963 X:152605921-152605943 AAAGTAAATGATGAGTTGATGGG - Intergenic
1200012486 X:153129199-153129221 CAAGTGAATGTTTAGTAAATGGG + Intergenic
1200027113 X:153270720-153270742 CAAGTGAATGTTTAGTAAATGGG - Intergenic
1200503114 Y:3976782-3976804 AGAGTAAAGTTCTAGTTGATAGG - Intergenic
1200909618 Y:8518121-8518143 AATGTGAATGGTGAGTTGATGGG + Intergenic
1201360471 Y:13141937-13141959 AAAGTGAATTTATTGTAGACAGG - Intergenic