ID: 972411911

View in Genome Browser
Species Human (GRCh38)
Location 4:38803340-38803362
Sequence GAATTTGTGTGAGGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 783
Summary {0: 1, 1: 2, 2: 87, 3: 178, 4: 515}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972411911_972411916 -8 Left 972411911 4:38803340-38803362 CCTTATGCCCCTCACACAAATTC 0: 1
1: 2
2: 87
3: 178
4: 515
Right 972411916 4:38803355-38803377 ACAAATTCTTTCCACTGAGGAGG 0: 1
1: 1
2: 27
3: 230
4: 528
972411911_972411918 21 Left 972411911 4:38803340-38803362 CCTTATGCCCCTCACACAAATTC 0: 1
1: 2
2: 87
3: 178
4: 515
Right 972411918 4:38803384-38803406 TTAAGTTTCTACGACCCATATGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972411911 Original CRISPR GAATTTGTGTGAGGGGCATA AGG (reversed) Intronic
900753039 1:4411755-4411777 GAATTCGACTGAGGGGCATAAGG + Intergenic
901164677 1:7209883-7209905 GAATCTGCGTGAAGGGCATATGG - Intronic
901245137 1:7724370-7724392 GAAACTGAGTGAGGGGCATATGG + Intronic
901278004 1:8007994-8008016 GAATCTGGGTAATGGGCATAGGG + Intronic
901729202 1:11266582-11266604 GAATTCAACTGAGGGGCATAAGG + Intergenic
902120719 1:14163152-14163174 GAATTTATCTGAGGGGCATAAGG + Intergenic
902975001 1:20082051-20082073 GAATTCGACTGAGGGACATAAGG + Intronic
905048119 1:35024822-35024844 AAAATTGTGTGAGGTGCATTGGG - Intronic
905051895 1:35058918-35058940 GAATTCAACTGAGGGGCATAAGG - Intergenic
905121409 1:35684956-35684978 GACATTGAGTGAGGGGTATAAGG - Intergenic
905610161 1:39343751-39343773 GAATTTGACCAAGGGGCATAAGG + Intronic
905931985 1:41794856-41794878 GAAATTGTTTGAAGGGTATATGG - Intronic
905971633 1:42146170-42146192 GTGTGTGTGTGAGTGGCATATGG - Intergenic
906754578 1:48297878-48297900 GAATTTGTGTAAGTACCATATGG - Exonic
906755148 1:48305061-48305083 TAGTCTGTGTAAGGGGCATAAGG + Intronic
906831378 1:49035302-49035324 GAATTTGATTGAGGGGCATAAGG + Intronic
907079423 1:51607768-51607790 GAATTTGGCCAAGGGGCATATGG + Intronic
907278772 1:53331535-53331557 TAATTTCTGTGAGGGGCAAAGGG + Intergenic
908948087 1:69524283-69524305 GAATTTGACTGAGGAGCACATGG + Intergenic
909084369 1:71154299-71154321 GAATTTGACTGAGGAGCATAAGG - Intergenic
909100499 1:71342593-71342615 GAATTTGACTGAGGGGCATAAGG + Intergenic
909201426 1:72694197-72694219 GAACTTGGCTAAGGGGCATAAGG + Intergenic
909590750 1:77346501-77346523 GAATTTTTTTGTGGGGGATAGGG + Intronic
909713054 1:78673894-78673916 GAGTTTAACTGAGGGGCATAAGG + Intergenic
909804500 1:79858060-79858082 GAATTCAATTGAGGGGCATAAGG + Intergenic
910024069 1:82627993-82628015 GAATTCGACAGAGGGGCATAAGG + Intergenic
910365398 1:86459878-86459900 GAATTTGACCGAGGGGCATAAGG + Intergenic
911159284 1:94668268-94668290 GAATTCGTCTGAGGGGCATAAGG - Intergenic
912187168 1:107292274-107292296 AAATTCGACTGAGGGGCATAAGG + Intronic
912187259 1:107292978-107293000 GAATTCATCTGAAGGGCATAAGG - Intronic
912237337 1:107866255-107866277 GAATTCGACTGAGGGGCATAAGG - Intronic
912626977 1:111213417-111213439 GATTTTGACTGAGGGGAATAAGG + Intronic
913204665 1:116526354-116526376 AAAATTTTGTGAAGGGCATAAGG + Intronic
913367067 1:118050386-118050408 GAATTCAACTGAGGGGCATAAGG - Intronic
913524531 1:119678385-119678407 GAATTCAACTGAGGGGCATAAGG + Intronic
914318820 1:146539898-146539920 GAATTTGACTGAGGGGCATAAGG + Intergenic
914418078 1:147503229-147503251 GAAGTTGTGGCAGGGGCAAAAGG + Intergenic
914495538 1:148193459-148193481 GAATTTGACTGAGGGGCATAAGG - Intergenic
915330741 1:155110855-155110877 GAATGTGTGTAAGGGGCCTCTGG - Intergenic
915342865 1:155185758-155185780 GAATGTGTGTGAGGGGGCTGGGG - Intronic
916706513 1:167356631-167356653 GAATTCGACTGAGGGGCATAAGG + Intronic
917353793 1:174105400-174105422 GAATTCAACTGAGGGGCATAAGG + Intergenic
917540655 1:175910565-175910587 GAATTTGACTCAAGGGCATAAGG + Intergenic
917567364 1:176226527-176226549 GAATTAGACTGCGGGGCATAAGG - Intergenic
918324548 1:183396831-183396853 GAACTCGACTGAGGGGCATAAGG - Intronic
918403439 1:184187915-184187937 GAATTTGACTAAGGGGCCTAAGG - Intergenic
918788884 1:188800042-188800064 GAATTTGACTAAGGTGCATAGGG + Intergenic
919298522 1:195732806-195732828 GAATTCGACTGAGGGGCACAAGG - Intergenic
920324706 1:205154133-205154155 GAGTTTGGGTGAAGGGTATATGG + Intronic
920501868 1:206490585-206490607 GAAATTGTGTGAGGGCCCCAGGG - Intronic
921294846 1:213692036-213692058 GAATTTGACTGAAGGACATAAGG + Intergenic
921463439 1:215456614-215456636 GAAGATGTGTGATGGGCTTATGG - Intergenic
922663445 1:227449445-227449467 GAATTTGACTGACGGGCAGAAGG + Intergenic
922824737 1:228510018-228510040 GAAGGTGTGTGAGGGGGTTAGGG + Intergenic
922875396 1:228936425-228936447 AAATTCGACTGAGGGGCATAAGG - Intergenic
924298275 1:242611168-242611190 GAATTTGACTGAGGGGCAGAAGG + Intergenic
924601743 1:245496266-245496288 GAATCTGGATGAGGGGCATATGG + Intronic
924752737 1:246910558-246910580 GAATTTGGGTGATGGGTTTATGG + Intronic
1062947608 10:1473256-1473278 GAATTCGCCTGAGGGGCATAAGG - Intronic
1062986506 10:1773913-1773935 GAATTTGGCCAAGGGGCATAAGG - Intergenic
1063786579 10:9391917-9391939 GAATTTGACTGAGGGGCATAAGG + Intergenic
1064405087 10:15054403-15054425 GAATTTGACCAAGGGGCATAAGG - Intronic
1064813710 10:19232055-19232077 GAAGTAGGGTGAGGGACATAGGG + Intronic
1065209608 10:23390133-23390155 GAATTTGACTAAGGGGCATAAGG + Intergenic
1065309269 10:24398474-24398496 CAATTTGACTGAGGGGCCTAAGG + Intronic
1065506504 10:26435101-26435123 GAATTCAACTGAGGGGCATAAGG - Intergenic
1065534839 10:26706866-26706888 GAATTCGACTGAGGGGCCTAAGG + Intronic
1065640349 10:27776064-27776086 GAATGCGACTGAGGGGCATAAGG + Intergenic
1066084420 10:31962478-31962500 GGATTTGACTGAGGGGCAGAAGG + Intergenic
1066289263 10:33998941-33998963 GAATTCGACTGAGGGGCATAGGG + Intergenic
1067347834 10:45450242-45450264 TAATTTTTGTGAAGAGCATAAGG - Intergenic
1067399121 10:45954883-45954905 GGATTTGATTGAGAGGCATAAGG - Intergenic
1067469516 10:46526301-46526323 GAATTTGTGTGTGAGGTATGTGG - Intergenic
1067867442 10:49924099-49924121 GGATTTGATTGAGAGGCATAAGG - Intronic
1067893936 10:50159860-50159882 GAATTTGACGGAGGGGCATAAGG - Intergenic
1067954909 10:50780404-50780426 GAATTTGACTGAGGGGCATAAGG + Intronic
1068056704 10:52020451-52020473 GAATTCGATGGAGGGGCATAAGG + Intronic
1068191989 10:53664622-53664644 GAATTTGACTGAGGGGCATAGGG + Intergenic
1068438520 10:57020933-57020955 GAATTTGACTGAGGGGCATAAGG - Intergenic
1068497103 10:57796394-57796416 GAATTTGACTGAGGGGCATAAGG - Intergenic
1069107136 10:64397093-64397115 GAATTTGACTCAGGGGCATAAGG + Intergenic
1069174318 10:65271335-65271357 GAATTCGACTGAGGGGCATAAGG + Intergenic
1069330288 10:67283766-67283788 GAATTTGACCGAGGGGCATAAGG - Intronic
1069817535 10:71208000-71208022 GAGACTGGGTGAGGGGCATATGG + Intergenic
1070269307 10:74937085-74937107 GTATTTGTGTGTGTGGAATAAGG + Intronic
1072356573 10:94617449-94617471 GAAATAATTTGAGGGGCATAAGG + Intergenic
1072488230 10:95876743-95876765 GAAGTTCTGTGATGGGCACATGG - Exonic
1072531194 10:96321140-96321162 GAATTCGACTGGGGGGCATAAGG + Intronic
1073932085 10:108587461-108587483 GAATTCTACTGAGGGGCATAAGG - Intergenic
1074002690 10:109388355-109388377 GAATTTGACTGAGGGGCATAAGG - Intergenic
1075618986 10:123911898-123911920 GAATTCGACTGAGGGGCATAAGG + Intronic
1075924257 10:126237381-126237403 GAATTGGGGTGATGGGTATAGGG - Intronic
1076429941 10:130394811-130394833 GAATTCCACTGAGGGGCATAAGG - Intergenic
1076480285 10:130780354-130780376 GAATTCGTCCGAGGGGAATAAGG - Intergenic
1077753731 11:5003042-5003064 GAAATTGACTGAGGGGCATAAGG + Intergenic
1077839181 11:5955434-5955456 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1078129685 11:8602982-8603004 GAATCTGGGTGAAGGACATATGG - Intergenic
1078281265 11:9903517-9903539 GAATTGGACTGAGGGGCATAAGG + Intronic
1078737877 11:14037556-14037578 TAATTTTTGTGAGGGGTGTAAGG - Intronic
1078819314 11:14861678-14861700 GAATTCAACTGAGGGGCATAAGG + Intronic
1079471926 11:20786643-20786665 AAATTTATCTGAGGGGCATAAGG + Intronic
1079557781 11:21782392-21782414 GAATTCGACTGAGGGGTATAAGG + Intergenic
1079576035 11:22003967-22003989 GAATTCCAGTGAGGGGCAAAAGG - Intergenic
1080320302 11:31000876-31000898 GAATCTGGGTGAAGGGTATATGG - Intronic
1081159021 11:39731300-39731322 GAATTTGACTGAGGGGCATAAGG + Intergenic
1081253960 11:40869918-40869940 GAATTAGACTGAGGGGCCTAAGG - Intronic
1081295719 11:41386378-41386400 GAAGCTGTGTGAAGGGCATATGG - Intronic
1081305015 11:41501437-41501459 GAATTTGGCTGAGGGGCAGAAGG + Intergenic
1081629043 11:44675441-44675463 GAAGCTGAGTGAAGGGCATATGG + Intergenic
1082942725 11:58725601-58725623 GAATTTGACTGAGGGGCAGAAGG + Intronic
1082943078 11:58728419-58728441 GAATTCAACTGAGGGGCATAAGG - Intronic
1084375511 11:68774224-68774246 GAATTTGACTGTGGGGCAGAAGG - Intronic
1084988310 11:72897837-72897859 GAATTTTTCTGAGGAGGATATGG - Intronic
1085002308 11:73050277-73050299 GAAGTGGTGTGAAGGTCATATGG - Intronic
1085622007 11:78044674-78044696 GAATTAGTCGGAGGGGCATAAGG + Intronic
1086363331 11:86081880-86081902 TAATTTTTGTGAAAGGCATAAGG + Intergenic
1086533156 11:87810893-87810915 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1086978295 11:93163177-93163199 GAAACTGGGTGAGGGGTATATGG - Intronic
1087081618 11:94176550-94176572 GAAACTGAGTGAGGGGCTTATGG + Intronic
1087236518 11:95724561-95724583 GAAATTGAGTGTGGGGTATATGG + Intergenic
1087474793 11:98622018-98622040 CAATTTTTGTGAAGGGTATAAGG + Intergenic
1087689946 11:101309077-101309099 GAATTTGTGTGGTGGGTACATGG - Intergenic
1087797507 11:102470075-102470097 GAATTTGACTGAGGGGCATAAGG - Intronic
1088561646 11:111121627-111121649 GGAGTTGGGTGAGGGGCAGAGGG + Intergenic
1089055593 11:115582367-115582389 GAATTTGACCAAGGGGCATAAGG + Intergenic
1090980236 11:131713765-131713787 GACTTAGACTGAGGGGCATAAGG + Intronic
1091294813 11:134466283-134466305 GAATTTGTGTGAAGAGCATAAGG + Intergenic
1091757940 12:3067508-3067530 CAATTCGACTGAGGGGCATAAGG - Intergenic
1092131043 12:6113640-6113662 GAATCTGAGTGAGGAGTATATGG + Intronic
1092575112 12:9774410-9774432 GAATTTGACCAAGGGGCATAAGG + Intergenic
1092683492 12:11015460-11015482 GAATTCAACTGAGGGGCATAAGG - Intronic
1093653275 12:21668535-21668557 GAATTTGACTGAGGGTCACAAGG + Intronic
1094374974 12:29780478-29780500 GGATTTGGGTGAGGGGATTATGG + Intronic
1094395878 12:30005334-30005356 GAATCTGGGTAAGGGGTATATGG + Intergenic
1095211546 12:39500593-39500615 GAATTAGACTGAGGGGCACAAGG + Intergenic
1095314748 12:40746424-40746446 GAATTTGACTGAGGGGCATAAGG + Intronic
1096130998 12:49158913-49158935 GAATTCCACTGAGGGGCATAAGG + Intergenic
1096580021 12:52579064-52579086 GAGTGTGTGTGAGGGGAAAAGGG - Intergenic
1096996766 12:55842979-55843001 GAATTTGGGGGAGAGGCAGAGGG + Intergenic
1097133357 12:56830768-56830790 GAATTAGACTGAGGGTCATAAGG + Intergenic
1097134147 12:56837341-56837363 GAATTTGACTGAGGGGCATAAGG + Intergenic
1097451469 12:59741898-59741920 TAATTTGACTGAGGGGCATAAGG + Intronic
1097931566 12:65193161-65193183 GAATTCGACTGAGAGGCATAAGG + Intronic
1098041479 12:66357826-66357848 GAATTTGTGTGTGGGGAAGGTGG + Intronic
1098055763 12:66503576-66503598 GAATTCAACTGAGGGGCATAAGG - Intronic
1099102368 12:78458833-78458855 GAATTTGACTGTGGGGCATAAGG + Intergenic
1099437430 12:82660578-82660600 GAATTCAACTGAGGGGCATAAGG + Intergenic
1099687805 12:85911396-85911418 TAATTTAACTGAGGGGCATAAGG - Intergenic
1099954440 12:89339243-89339265 GAAATTGGGGGAGGGGGATAAGG + Intergenic
1100135791 12:91551965-91551987 TAATTTGACTGAGGGGCGTAAGG + Intergenic
1100135956 12:91553572-91553594 GAATTCGGCTGAGGGGCATAAGG - Intergenic
1100569969 12:95838099-95838121 CAATTTGACTGAGGGGCAGAAGG + Intergenic
1100758408 12:97777676-97777698 TAATTTGTCTCAGGGGCATAAGG - Intergenic
1101280827 12:103253737-103253759 GAATTTGACTGAGGGGCATAAGG - Intronic
1101296745 12:103431862-103431884 GAATTTAACTGAGGGGCATAAGG + Intronic
1101586245 12:106088359-106088381 GAATTAGGGTGCTGGGCATAGGG - Intronic
1101649543 12:106662726-106662748 TAATTTTTGTGATGGGTATAAGG + Intronic
1102742295 12:115218345-115218367 GAGTATGTGTGAGTGGTATACGG - Intergenic
1103126719 12:118429674-118429696 GAATTCGACTGAGGGGGATAAGG + Intergenic
1103292361 12:119857139-119857161 GTATTTGTGTTGTGGGCATATGG - Intronic
1103554759 12:121759322-121759344 GAATTTGACTGAGGGGCATAAGG + Intronic
1104284409 12:127411758-127411780 GAATTTGCCCGAGGGGCATATGG + Intergenic
1104361819 12:128140312-128140334 GAATCTGAGTGATGGGCATGTGG + Intergenic
1104683430 12:130768198-130768220 GAATTCGACTGAGGGGCATGAGG - Intergenic
1105696432 13:22893624-22893646 GAATTCAGCTGAGGGGCATAAGG - Intergenic
1106174051 13:27313490-27313512 TAATTTTTGTGAGTGGCATAAGG + Intergenic
1106285088 13:28311414-28311436 GAATTTAGGGGATGGGCATATGG + Intronic
1106294171 13:28394941-28394963 GACTATCTGTGAGGGGCATGGGG + Intronic
1106545031 13:30723268-30723290 TGATTTTTGTGAGGGACATAAGG + Intronic
1107122922 13:36814782-36814804 GAATTTGACCGAGGGGCCTAAGG - Intergenic
1107508077 13:41055465-41055487 GAGTTTGTGTGAGGGGAATGAGG - Intronic
1107649513 13:42530076-42530098 TAATGTGTGTGAGGGGGATTGGG - Intergenic
1108353076 13:49604957-49604979 GAACTTGACTGAGGGGCATAAGG - Intergenic
1108440813 13:50451056-50451078 GAACTTATGTGATGGGCATGAGG + Intronic
1108483047 13:50894756-50894778 GAATTTGGCTCAGGGGCATAAGG - Intergenic
1108702140 13:52952816-52952838 GAATTCGACTGAGAGGCATAAGG + Intergenic
1108718386 13:53105016-53105038 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1108808331 13:54187263-54187285 TAATTTGATTGAGGGGAATAAGG - Intergenic
1109176830 13:59167467-59167489 GAATTTGACGGAGGGGCATAAGG + Intergenic
1109267410 13:60217224-60217246 GAATTCCACTGAGGGGCATAAGG + Intergenic
1109359939 13:61282635-61282657 GAATTTGACTGAGGGGTATAAGG + Intergenic
1110145225 13:72182459-72182481 GAAATTGGGTGAGGGGTATACGG + Intergenic
1110491316 13:76111818-76111840 TAATTTTTGTGAAGGGTATAAGG + Intergenic
1110930695 13:81212328-81212350 GAATTTGTCCAAGGGGCATAAGG - Intergenic
1110937360 13:81307645-81307667 GAATTTGACTGAGGGGCATGAGG - Intergenic
1110952514 13:81514366-81514388 GAATTTGACTGAGGGTCCTAAGG - Intergenic
1111132380 13:83994117-83994139 TAATTTTTGTGAAAGGCATATGG - Intergenic
1111135399 13:84036167-84036189 GAATTCCACTGAGGGGCATAAGG + Intergenic
1111151157 13:84254856-84254878 GAATTTGACTGAGCGGCATAAGG - Intergenic
1111344119 13:86926330-86926352 GACTTTGACTGAGGAGCATAAGG + Intergenic
1111434127 13:88184235-88184257 GATTTTGACTGAGGGGCATAAGG - Intergenic
1111763493 13:92496899-92496921 GAATTCAACTGAGGGGCATAGGG + Intronic
1111798872 13:92958266-92958288 CAATTTGACTGAGGGGCATAAGG - Intergenic
1111934754 13:94547480-94547502 GAATTCGACTGAAGGGCATAAGG - Intergenic
1112019218 13:95357260-95357282 GAATTCATCTGAGGGGCATAAGG - Intergenic
1112170977 13:96971392-96971414 GAATTCAACTGAGGGGCATAAGG + Intergenic
1114326849 14:21598028-21598050 GGATTTGTGTGGGGGGCGGAGGG - Intergenic
1114387433 14:22269618-22269640 GAATTTGACTGAGGGAAATAAGG - Intergenic
1114565367 14:23627983-23628005 GAATTCGACTGAGGGGCACAAGG - Intergenic
1115239346 14:31239585-31239607 GAATTCGACCGAGGGGCATAAGG + Intergenic
1115298857 14:31861127-31861149 GAAATTGGGTGAAGGGCACATGG + Exonic
1115535428 14:34368576-34368598 AAATTTATGTGGAGGGCATATGG + Intronic
1115887956 14:37994633-37994655 GAATTTGACTGAGGGGCATAAGG - Intronic
1116173321 14:41430639-41430661 GAATTCGACTGAGGGGCATAAGG - Intergenic
1116276413 14:42839277-42839299 GAATTTGACTGAGGGGCATAAGG - Intergenic
1116341260 14:43726164-43726186 GAATTTGACTGAGGGGCATAAGG - Intergenic
1116479592 14:45382699-45382721 AAATTTGACTGATGGGCATAAGG + Intergenic
1116566175 14:46446942-46446964 GAATTCGACTGAGGGGCATAAGG - Intergenic
1116708584 14:48335571-48335593 AAATTTGACTGAGGGGCAGAAGG - Intergenic
1117099713 14:52333874-52333896 GAATTCGGCTGAGGGGCATAAGG + Intergenic
1117178363 14:53168348-53168370 GAATTGAACTGAGGGGCATAAGG + Intergenic
1117197250 14:53353036-53353058 GAATTCGACTGAGGAGCATAAGG - Intergenic
1119064764 14:71514024-71514046 AAAATTGACTGAGGGGCATAAGG + Intronic
1119188946 14:72665830-72665852 GAATCTGGGTGAAGGACATATGG + Intronic
1119298443 14:73552160-73552182 GAATTTGACTGAGGGGCATAAGG - Intronic
1119302740 14:73584347-73584369 GAATTTGACTGAGGGGCATAAGG - Intergenic
1119596974 14:75944120-75944142 GAATTTGACTGAGGGGCATAAGG - Intronic
1119822514 14:77630004-77630026 GAATTTGAGCAAGGGGCATAAGG + Intergenic
1119952316 14:78757826-78757848 AAAATTGGGTGAAGGGCATATGG + Intronic
1120251756 14:82067318-82067340 TATTTTCTGTGAGGGGAATAAGG + Intergenic
1120376110 14:83709244-83709266 GAATTTGTCCAAGGGGCATAAGG - Intergenic
1120477591 14:85008044-85008066 TAATTTCACTGAGGGGCATAAGG + Intergenic
1120509440 14:85395827-85395849 GAACTGGTGGGAGGGGGATAAGG + Intergenic
1120538152 14:85722407-85722429 GAATTTGACCAAGGGGCATAAGG - Intergenic
1120970000 14:90199276-90199298 GAATTTGACTGAGGGGCATAAGG - Intergenic
1121004278 14:90478452-90478474 GAATTTGACTGAGGGGCATAAGG + Intergenic
1122144652 14:99682489-99682511 GAATTCGACTGAGGGGCGTAAGG - Intergenic
1122851027 14:104531181-104531203 GAAGCTGTGTGAGGGCTATATGG - Intronic
1122964487 14:105115742-105115764 GAATTTGACTGTGGGGCACAAGG + Intergenic
1123431009 15:20216337-20216359 GAATTCGACTGAGGGGCAGAAGG - Intergenic
1123778304 15:23601951-23601973 GAATTCGACTGAGGGGCATAAGG + Intronic
1124065242 15:26336556-26336578 GAAGTTGTGTGATGAGCACATGG - Intergenic
1124839174 15:33225948-33225970 GTATTTGTGTGTGGGGCTTTGGG + Intergenic
1125355204 15:38810390-38810412 AAATTTCTCTGAGGTGCATATGG + Intergenic
1126597011 15:50393049-50393071 GAATTTGACTGAGGGGCATAAGG - Intergenic
1127365951 15:58290626-58290648 GGAGCTGTGTGATGGGCATATGG - Intronic
1127575122 15:60284463-60284485 GAATTTGTCTGAGGAGCATAAGG + Intergenic
1128849835 15:70943306-70943328 GAATTTGACTGAGGGGCATAAGG + Intronic
1130749286 15:86692749-86692771 GAAATGGTGTGAGGGGGATGAGG - Intronic
1131010059 15:89009828-89009850 GGTTTTGACTGAGGGGCATAAGG - Intergenic
1131103358 15:89712244-89712266 GAAGCTGGGTGAAGGGCATAAGG - Intronic
1131113630 15:89780557-89780579 GGGTTTGTGTGAGGTGCTTAGGG + Intergenic
1131287128 15:91069577-91069599 GAATTTGACCGAGGGACATAAGG + Intergenic
1131661623 15:94523570-94523592 GAATTTGTCCAAGGGGCATAAGG + Intergenic
1132123041 15:99194591-99194613 CAATTTTTGTGAAGGGTATAAGG - Intronic
1135433725 16:22410254-22410276 TAATTTTTGTGAAGGGTATATGG + Intronic
1135736009 16:24932210-24932232 GAAACTGAGTAAGGGGCATATGG + Intronic
1135907686 16:26528238-26528260 GCATTTGTGTGCAGGGTATATGG - Intergenic
1136110202 16:28059735-28059757 CAATTTGTGTGAAGGGCTTGGGG + Intronic
1136853644 16:33634910-33634932 TAATTTGACTGAGGGGCAGAAGG + Intergenic
1137386925 16:48050397-48050419 GAATTTGTCTGAGGGGCATAAGG - Intergenic
1137746193 16:50821918-50821940 GAATTCAACTGAGGGGCATAAGG + Intergenic
1138201124 16:55089268-55089290 CATTTTGTTTGAGTGGCATATGG + Intergenic
1138313078 16:56044781-56044803 TTATTTGGGTGAGGGGCAAAGGG - Intergenic
1138522844 16:57581384-57581406 GAGTTTGACTGAGGGGTATAAGG + Intronic
1138743092 16:59333296-59333318 GAATGAGAGGGAGGGGCATAAGG + Intergenic
1138748282 16:59389175-59389197 GAATTCGACTGAGGGGCATAAGG + Intergenic
1138770018 16:59652142-59652164 GAGTTTGTGTGGGGGGGAAAGGG - Intergenic
1140128057 16:72134216-72134238 GAATTTGACTGAGGGGCAGAAGG - Intronic
1140323643 16:73978469-73978491 GAATTTGTCCGAGGGGTGTAAGG - Intergenic
1141505984 16:84479040-84479062 GAATGTGTGTGAGGAACAGATGG - Exonic
1142277302 16:89127369-89127391 TATTTTGTGTGTGGGGGATAAGG + Intronic
1203115235 16_KI270728v1_random:1483355-1483377 TAATTTGACTGAGGGGCAGAAGG + Intergenic
1144300589 17:13919892-13919914 GAATTTGACTGAGGGGCATAAGG - Intergenic
1147272529 17:39285784-39285806 GAATTTGAATGAGGGGAAGATGG + Intronic
1147349859 17:39833808-39833830 GAAATTGGGTGTGGGGTATATGG - Intronic
1147839607 17:43361903-43361925 GACTTTAGGTGATGGGCATACGG - Intergenic
1148225662 17:45896430-45896452 GAATGTGAGGAAGGGGCATAAGG + Intronic
1148435105 17:47677889-47677911 GAGTTGGTGTGAGGTGCAAATGG + Intronic
1148956818 17:51361047-51361069 GAATTTGACTGAGGGGCATAAGG + Intergenic
1149258126 17:54849985-54850007 GAATTCAACTGAGGGGCATAAGG - Intergenic
1149289428 17:55202146-55202168 GGATATGAGTGTGGGGCATAAGG - Intergenic
1149799562 17:59554769-59554791 TAATTCGACTGAGGGGCATAAGG + Intergenic
1150616470 17:66776256-66776278 GAATTTGACTGTGGGGCATCAGG + Intronic
1150827891 17:68492727-68492749 GAATTTGACTGAGGGGCATAAGG + Intergenic
1150907067 17:69349118-69349140 GAATCTGATGGAGGGGCATAAGG - Intergenic
1151051747 17:70985916-70985938 GAATTCAACTGAGGGGCATAAGG + Intergenic
1151686915 17:75652881-75652903 GATTTTGTGAGAGGGGCTTTGGG - Intronic
1153101491 18:1475676-1475698 GAATTTGACCTAGGGGCATAAGG + Intergenic
1153315749 18:3719656-3719678 GAAACTGTGTGAGGGGTACAGGG + Intronic
1153539353 18:6137076-6137098 GAGTTTGTCCCAGGGGCATAAGG - Intronic
1154043385 18:10881271-10881293 GGATTTGTGTGAGTGCCACACGG + Intronic
1154044821 18:10894834-10894856 GAATCTGACTGAGGGGCACAAGG - Intronic
1154363751 18:13687854-13687876 GAATTTGACTGATGGGCGTAAGG - Intronic
1155937524 18:31769348-31769370 TAAGTTCTGTGAGAGGCATAAGG - Intergenic
1156254408 18:35381403-35381425 GAGTTTGTGTGAGGGAACTAGGG + Intergenic
1156291233 18:35750225-35750247 GAATTTGACTGACGGGCATAAGG + Intergenic
1156644293 18:39141144-39141166 TAATTTGACTGACGGGCATAAGG - Intergenic
1156669373 18:39449382-39449404 GAAGATGAGTGAGAGGCATATGG + Intergenic
1158051689 18:53228832-53228854 GAGTGTGTGTTAGGGGAATAGGG - Intronic
1159054629 18:63451591-63451613 GAATTCGACTGAGGGGCATGAGG + Intergenic
1159324957 18:66902758-66902780 AAATTTGACTGAGGGGCATAAGG - Intergenic
1159539946 18:69761928-69761950 GAATTCTACTGAGGGGCATAAGG + Intronic
1159654423 18:71014792-71014814 GCATTTGACTGAGGGGCATAAGG - Intergenic
1159745671 18:72231972-72231994 GAATTCGACTGAGGGGCATATGG + Intergenic
1159892724 18:73967915-73967937 GAATTTAGCCGAGGGGCATAAGG + Intergenic
1160105111 18:75966384-75966406 GAATTTGACCAAGGGGCATAAGG - Intergenic
1160542869 18:79634651-79634673 GACTTTGGGGGAGGGGCACATGG - Intergenic
1164465612 19:28485107-28485129 GAATTTGACTAAGGGGCATAAGG + Intergenic
1164601625 19:29566876-29566898 GAAGTGGTGTGATGGGCACAAGG + Intergenic
1165208813 19:34216027-34216049 GAAGTTGGGTGATGGGCACAAGG + Intronic
1165692359 19:37873531-37873553 GAATTCGACCGAGGGGCATAAGG + Intergenic
1166418503 19:42614173-42614195 GAATTTGACTAAGGGGCATAAGG - Intronic
1166811069 19:45515021-45515043 GACTTTGGGGGAGGGGCTTAAGG + Intronic
1167222974 19:48215157-48215179 GAATTTGACTGAGGGGCATAAGG - Intronic
1168517890 19:57023662-57023684 GAATTTGACTGTGGGGCATAAGG - Intergenic
925200031 2:1959675-1959697 GGAGGTGTGTGAGGGGCAGAGGG - Intronic
925552794 2:5094230-5094252 AAATTTGACTGAGGGGCATAAGG - Intergenic
925587459 2:5477357-5477379 GAATTTGACTAAGCGGCATAAGG - Intergenic
925751620 2:7094865-7094887 GAATTCAACTGAGGGGCATAAGG - Intergenic
925833765 2:7922822-7922844 GAAGTGGGGTGAGGGGCATGTGG + Intergenic
926439570 2:12874111-12874133 GTATTTGACTGAGGGGCATAAGG + Intergenic
926502711 2:13675580-13675602 GAATTTGAGTGAGGGGCATGAGG + Intergenic
926556495 2:14364028-14364050 GAATTCATCTGAGGGGCATAAGG + Intergenic
927351530 2:22123007-22123029 GAATTTGACTGAGGGGCATAAGG - Intergenic
927551922 2:24008965-24008987 GAATTCCACTGAGGGGCATAAGG + Intergenic
927877000 2:26664426-26664448 TAATTTTTGTGAAGGGTATAAGG + Intergenic
928183863 2:29091668-29091690 GAACTCGACTGAGGGGCATAAGG + Intergenic
928205072 2:29278198-29278220 GAACTGGTGTGAGGGCCATGTGG + Intronic
928558648 2:32454060-32454082 TTATTTGTGGGAGGGGCATTTGG + Intronic
928650552 2:33399736-33399758 GAATTTGACTGAGGGGTATAAGG + Intergenic
928819789 2:35346491-35346513 GAATATTTTTGGGGGGCATAGGG + Intergenic
928854941 2:35791683-35791705 GAATTTGACTGAGGGGCATAAGG - Intergenic
930119877 2:47751788-47751810 GAATTTGAGTGAGGGGCGTAAGG + Intronic
930591050 2:53326757-53326779 GAATTTGACTGAGGGGCACAAGG - Intergenic
930771717 2:55136553-55136575 GAATTCATCTGAGGGACATAAGG - Intergenic
930898704 2:56477122-56477144 GAATTATGCTGAGGGGCATAAGG - Intergenic
930946938 2:57085759-57085781 GAATTCGACTGATGGGCATAAGG + Intergenic
931114433 2:59149054-59149076 GAATTCAGCTGAGGGGCATAAGG - Intergenic
931439199 2:62275870-62275892 GAACTTATGCGAGGGGCAAACGG - Intergenic
931885033 2:66607907-66607929 GAATTAGAGTGAGGTGCATAAGG - Intergenic
932005588 2:67924003-67924025 CAATTCGAGTGAGGGGCATAAGG - Intergenic
932400909 2:71480701-71480723 GAAGTTGTGTGATTGGCATTGGG + Intronic
932870223 2:75390943-75390965 CAATTTGACTGAGGGGCATAAGG + Intergenic
932961339 2:76415680-76415702 GAATTCAACTGAGGGGCATATGG - Intergenic
933069189 2:77836339-77836361 GAATTTGGCTGAGGGGCATAGGG - Intergenic
933451474 2:82458585-82458607 GAATTAGATTGAGGGACATAAGG + Intergenic
933563123 2:83913844-83913866 GAATTTGACCTAGGGGCATAAGG - Intergenic
934165686 2:89292141-89292163 GAATGCGACTGAGGGGCATAAGG - Intergenic
934201591 2:89890315-89890337 GAATGCGACTGAGGGGCATAAGG + Intergenic
934612296 2:95749962-95749984 AAATTTCTATGAGGGGTATATGG - Intergenic
934841856 2:97629486-97629508 AAATTTCTATGAGGGGTATATGG + Intergenic
935238060 2:101154246-101154268 GGAATAGTGTGAGGGGCATATGG + Intronic
935299965 2:101685612-101685634 GAATTTGACTGAGCGGCATAAGG + Intergenic
935331417 2:101980296-101980318 GAATTGATGTGAGGGGCTGAGGG - Intergenic
936035283 2:109106228-109106250 GAATTTCTCTAAGGGGCATAAGG - Intergenic
936093380 2:109514913-109514935 GGAAGTGTGTGAGGGGCATGGGG - Intergenic
936746420 2:115581956-115581978 GAATTTGGCTGAGGGACAGAAGG + Intronic
936837798 2:116728561-116728583 GCATTTGACTGAGGGGCATTAGG - Intergenic
936840614 2:116764081-116764103 GAATTCGACTGAGGGGCATAAGG + Intergenic
936877864 2:117213999-117214021 GAATTCGTCTGAGAAGCATAAGG - Intergenic
938056640 2:128220467-128220489 GAATTCAAATGAGGGGCATAAGG - Intergenic
938290757 2:130148858-130148880 GAATTCGACTGAGGGGCATAAGG + Intergenic
938465791 2:131524095-131524117 GAATTCGACTGAGGAGCATAAGG - Intergenic
938579768 2:132635514-132635536 CAATTGGTGTGAGAGGAATAGGG + Intronic
939080943 2:137661572-137661594 TAATTCATCTGAGGGGCATAAGG + Intronic
939195015 2:138961146-138961168 GAATTCGACTGAGGGGCATCAGG + Intergenic
939207673 2:139128522-139128544 GAATTTAACTGAAGGGCATAAGG + Intergenic
939858475 2:147389565-147389587 GAATTTGACTGAGGGGCATAAGG - Intergenic
940117531 2:150225476-150225498 GAATTTGACTGAGAGGCGTAAGG + Intergenic
940782984 2:157952924-157952946 AAATTTGGCTAAGGGGCATAAGG - Intronic
940868440 2:158839475-158839497 GAATGGGACTGAGGGGCATAAGG - Intronic
940919998 2:159295668-159295690 GAATTCATCTGAGGGACATAAGG - Intergenic
940987387 2:160062697-160062719 GAATTTCTGGGATGGGCAGATGG - Intergenic
942619564 2:177833069-177833091 GAATTTGACTGAGGGGCGTTAGG - Intronic
943068914 2:183118682-183118704 GAATCTGACTAAGGGGCATAAGG + Intronic
943499940 2:188675035-188675057 GAATTTGACTGAAGTGCATAAGG - Intergenic
943633580 2:190280948-190280970 GAATTTGTCTAAGGGGCATAAGG - Intronic
943750324 2:191503671-191503693 GAATTCAACTGAGGGGCATAAGG - Intergenic
943884661 2:193200365-193200387 GAACTTGGGTAAGGGACATAGGG + Intergenic
943903018 2:193465442-193465464 GAATTCGACTGAGGGGCATAAGG + Intergenic
943905160 2:193490067-193490089 GAATTTGACTGAGGGGTATAAGG - Intergenic
944050851 2:195467764-195467786 AAACTTTTGTTAGGGGCATAGGG + Intergenic
944553655 2:200867399-200867421 GAATTCGACTGAGGGGCAGAAGG - Intergenic
944586167 2:201175743-201175765 GAATTTGACTGAGGGGCATAAGG + Exonic
944709842 2:202325959-202325981 GAATTTGAGTAAAGGGTATATGG + Intergenic
944872994 2:203933081-203933103 GAATTTGACTGAGAAGCATAAGG - Intergenic
945021457 2:205576462-205576484 TAATTTTTGTGAAGGGCATAAGG + Intronic
945608830 2:211972729-211972751 AAATTTGTGTATGTGGCATAAGG - Intronic
946075256 2:217068619-217068641 GAACTGGTGTGTGTGGCATATGG + Intergenic
946710682 2:222502032-222502054 AAATTTGTGAGGGTGGCATAAGG - Intronic
946924556 2:224613900-224613922 GCATTTGTGTGAATGGTATAAGG + Intergenic
947237929 2:227963135-227963157 GAATTTGACCAAGGGGCATAAGG - Intergenic
948039454 2:234888032-234888054 CAACTTGTGTGAGGGGAATGAGG - Intergenic
948494825 2:238340748-238340770 GAATCTGGGTGAGAGGTATATGG - Intronic
948544068 2:238713470-238713492 GTATTTGTGTGTGGTGTATATGG - Intergenic
948704322 2:239779667-239779689 GGGGTTGTGTGAGGGGCACAAGG - Intronic
1169047975 20:2551664-2551686 TAATTTTTGTGAAAGGCATAAGG + Intronic
1169708717 20:8537103-8537125 GAATTTGACTGAGGGGCATAAGG + Intronic
1170045211 20:12077851-12077873 GAATTTGTGTGACAGGGATTTGG - Intergenic
1170195591 20:13686102-13686124 GAATATGGATGAAGGGCATATGG + Intergenic
1170342309 20:15342852-15342874 GAATCTGTGTGAAGAGCAGAGGG + Intronic
1170791617 20:19513481-19513503 AAATTAATGTGAGGGGCAGAGGG - Intronic
1171375764 20:24693299-24693321 CAAATTGGGTGAGGGGCATATGG + Intergenic
1172918009 20:38458478-38458500 GAAGCTGGGTGAAGGGCATATGG - Intergenic
1173721905 20:45266554-45266576 GAATCTGGGTGAAGGGAATATGG - Intergenic
1174868352 20:54160456-54160478 TCATTTGTGTGAGTGGCACATGG - Intronic
1175294894 20:57901629-57901651 AGCCTTGTGTGAGGGGCATAAGG + Intergenic
1175631004 20:60536378-60536400 GAATTTGACTGAGGGGCAGAAGG + Intergenic
1177024436 21:15904832-15904854 AGATTTGACTGAGGGGCATAAGG - Intergenic
1177547663 21:22579472-22579494 GAATTAGACTGAGGGGCATAAGG - Intergenic
1177559300 21:22729745-22729767 GAATTTGACTGAGGGGCATAAGG + Intergenic
1177938995 21:27385721-27385743 GAATTTGACTGAGGGACGTAAGG + Intergenic
1178123087 21:29489256-29489278 GAATTTGAATGAGGGGCAGAAGG - Intronic
1178524805 21:33318553-33318575 AAATTCGACTGAGGGGCATAAGG - Intergenic
1178837558 21:36111681-36111703 GAATTTGACTGAGGGGCATAAGG - Intergenic
1178841679 21:36142738-36142760 GAACTTAGGTGATGGGCATAGGG + Intronic
1179054735 21:37920636-37920658 GAATTCGACTGAGGGGCATAAGG - Intergenic
1179231850 21:39511160-39511182 GTATTTGTGTGTGGTGTATATGG + Intronic
1179254819 21:39706497-39706519 GAATTTGACTGAGGGGCATAAGG + Intergenic
1179267126 21:39813487-39813509 GAATGTGGGTAAGGGGAATATGG - Intergenic
1179619136 21:42601125-42601147 GAATTAGACTGAGGGGCATAAGG + Intergenic
1179915540 21:44475713-44475735 TAACTCGTCTGAGGGGCATAAGG - Intergenic
1181110028 22:20596879-20596901 GAATTCAACTGAGGGGCATAAGG + Intergenic
1181563376 22:23718464-23718486 GAATTTGACCGAGGGTCATAAGG + Intergenic
1183246088 22:36694587-36694609 GAATTTGTGGGAGGGTAATAAGG + Intronic
1183445745 22:37853264-37853286 GAATTCGACTGAGGGGCACAAGG + Intronic
949676453 3:6459837-6459859 GAACTTGACTGAGGGGCATAAGG + Intergenic
949786099 3:7743691-7743713 GAATTCGACTAAGGGGCATAAGG + Intergenic
950373443 3:12550703-12550725 GAATTCGACTGAGGGGCATAAGG - Intronic
950869457 3:16216205-16216227 GAATTCAACTGAGGGGCATAAGG + Intronic
951450787 3:22836125-22836147 AAATTCATCTGAGGGGCATAAGG + Intergenic
952228945 3:31409090-31409112 GAATTCAAGTGAGGGGCATAAGG - Intergenic
952454132 3:33457107-33457129 AAATTCGACTGAGGGGCATAAGG + Intergenic
952675818 3:36029194-36029216 GAATTTGACTGAAGGGCATAAGG + Intergenic
952687322 3:36164564-36164586 GATTTTGTCTGTGGGGCATACGG - Intergenic
953194546 3:40720232-40720254 GAATTTGTCTGAGGGGCATAAGG - Intergenic
953259335 3:41322394-41322416 AAATTTGTCTGAGGGGCATAAGG - Intronic
953798940 3:46006634-46006656 GAATTCAACTGAGGGGCATAAGG - Intergenic
953812363 3:46124215-46124237 GAATTTGACTAAGGGGCATAAGG - Intergenic
954349979 3:50035160-50035182 CAATTTGACTGAGGGTCATAAGG + Intronic
954588211 3:51755663-51755685 GAATTTGTTTGATGGGCTTATGG - Intergenic
954889574 3:53912932-53912954 GAATTTGACTGAGGGGCATAAGG + Intergenic
954931278 3:54284464-54284486 GAAGTTGGGTGAAGGGTATATGG + Intronic
955266822 3:57452085-57452107 GAATTCAACTGAGGGGCATAAGG - Intronic
955319999 3:57967631-57967653 GAATTTGACTGAGGGGCAAAAGG + Intergenic
955548723 3:60059614-60059636 GAATTCAGCTGAGGGGCATAAGG - Intronic
955824989 3:62936639-62936661 GAATTCGACTGAGGGGTATAAGG + Intergenic
956722907 3:72134003-72134025 GCATTTGTGTGAGGGAGAGAGGG - Intergenic
956724422 3:72145476-72145498 GCATTTCTGTGGGGGGCAGAAGG + Intergenic
956729481 3:72183610-72183632 GAATTTGTGTGAGTTCCTTACGG - Intergenic
956971761 3:74534255-74534277 TAAGTTGGGTGATGGGCATAAGG - Intergenic
957130971 3:76222253-76222275 GAATCTGACTGAGAGGCATAAGG + Intronic
957222599 3:77402958-77402980 GAATTCAACTGAGGGGCATAAGG - Intronic
957275083 3:78080747-78080769 GAATTTGATTGAGGGACATAAGG - Intergenic
957556992 3:81774759-81774781 AAAGTTGTGTGAAGGGCATATGG + Intergenic
957610806 3:82462946-82462968 GAATTTGACTAAGGAGCATAAGG + Intergenic
958435422 3:94089852-94089874 GAATTAGACTGAGGGGCATAAGG - Intronic
958603765 3:96332058-96332080 GAATTCGACTGAGAGGCATAAGG - Intergenic
959646457 3:108708617-108708639 TAATTTTTATGAAGGGCATAAGG + Intergenic
959649532 3:108738129-108738151 GAATTTGACGGAGGGGCATAAGG - Intergenic
960045813 3:113196874-113196896 GAAACTGGGTGAAGGGCATATGG - Intergenic
960528323 3:118735651-118735673 GAATTTGTGTTGGGAGCCTAGGG - Intergenic
960709412 3:120512277-120512299 GAATTCAACTGAGGGGCATAAGG - Intergenic
961481007 3:127180791-127180813 GAATTCGTCAGAGGGGCATAAGG - Intergenic
962359723 3:134727831-134727853 GAAGTTGGGTGATGGGAATATGG + Intronic
963156544 3:142103652-142103674 GAATCTGGGTGAAGGGCATCTGG + Intronic
963230745 3:142906661-142906683 GAATTCGACTGAGGGGCATATGG - Intergenic
963458058 3:145572678-145572700 GAATTTGACTGAGTGGCATAAGG + Intergenic
964249793 3:154699742-154699764 GAATTCAACTGAGGGGCATAAGG - Intergenic
964862366 3:161216975-161216997 GAATTTGACTGAGGGGCATAAGG - Intronic
964944059 3:162196854-162196876 GAGTTTGTGTGAGGTGAATGGGG + Intergenic
964973241 3:162586971-162586993 GAATTCGACTAAGGGGCATAAGG - Intergenic
966162620 3:176984154-176984176 GAACTCGACTGAGGGGCATAAGG - Intergenic
967430347 3:189377197-189377219 TAATTTTTGTGAAGGGTATAAGG + Intergenic
967430758 3:189382738-189382760 GAATTCGGCTGAGGGGCACAAGG + Intergenic
967974869 3:195028176-195028198 GAATTTGACTGACGGGCCTAAGG - Intergenic
968845834 4:3041149-3041171 GAATCTCGGTGAGGGGCACAAGG - Intergenic
969335754 4:6509017-6509039 GGATTCGTCTGAGGGGCAAAAGG - Intronic
969348435 4:6583630-6583652 GAATTCGACTGAGGGGCATAAGG + Intronic
969623529 4:8290973-8290995 CAGTTTGTGTGTGGTGCATATGG + Intronic
969947028 4:10793815-10793837 GAATTTGAACGAGGAGCATAAGG + Intergenic
970422757 4:15920493-15920515 GAATTTGACAGAGGGGCATAAGG - Intergenic
970471103 4:16380048-16380070 GAATTAGACTGAGGGGCATAAGG + Intergenic
970623845 4:17855693-17855715 GAGTTAGTGTGAGGGACACATGG + Intronic
971145700 4:23974197-23974219 GAATGTGTGTGTGTGGCATTGGG + Intergenic
971477875 4:27089407-27089429 GAATTTGGCCAAGGGGCATAAGG + Intergenic
971787157 4:31119475-31119497 GAATTTGACTCAGGGGCATAAGG + Intronic
971860354 4:32094092-32094114 GAATTTGACTGAGGGGCATAAGG + Intergenic
971955823 4:33416949-33416971 GAATTTGACTGAGGGGCATAAGG - Intergenic
971967374 4:33577808-33577830 GAATTTGACCGAGGGGCATGAGG + Intergenic
972241875 4:37202236-37202258 GAATTTGACTGAGGGGCATAAGG - Intergenic
972411911 4:38803340-38803362 GAATTTGTGTGAGGGGCATAAGG - Intronic
972865031 4:43221544-43221566 GAATACGACTGAGGGGCATAAGG + Intergenic
973930490 4:55789032-55789054 GTATTCGACTGAGGGGCATAAGG + Intergenic
974250994 4:59382479-59382501 GAATTCGACTGAGGTGCATAAGG - Intergenic
974328763 4:60449490-60449512 GAAATTGGGTGAGGAGCGTAAGG - Intergenic
974462350 4:62204572-62204594 GAATTTGACTGAGGGGCATAAGG - Intergenic
974691234 4:65300079-65300101 GAATTTGACTGAGGGGCATAAGG + Intergenic
974840090 4:67289371-67289393 GAATTTGACTGAGGGGAATAAGG - Intergenic
974876570 4:67710154-67710176 GAATTTGACTGAGGGGCATAAGG + Intergenic
974945297 4:68519624-68519646 GAATTTGACTGAGCGGCATAAGG - Intergenic
974955209 4:68630893-68630915 GAATTTGATTGAGGGGCACAAGG - Intronic
975033370 4:69652082-69652104 GAATTTGACTGGGGGGCATCAGG - Intronic
975247527 4:72136952-72136974 GGAATTGTGTGAGGGAGATAAGG + Intronic
975397636 4:73895533-73895555 TAATTTGACGGAGGGGCATAAGG - Intergenic
975485443 4:74930431-74930453 GAATATAATTGAGGGGCATAAGG + Intergenic
975703463 4:77089000-77089022 GAATTTGACTGAGGGGCATAAGG + Intergenic
975752549 4:77538904-77538926 GAATGAATTTGAGGGGCATAAGG + Intronic
976004964 4:80419079-80419101 GAATTTGACTGAGGACCATAAGG + Intronic
976008548 4:80459565-80459587 GAATTTGACTGAGGGGCATAAGG - Intronic
976307210 4:83572424-83572446 GAATTTGGGTGATGGGTATAAGG - Intronic
976818270 4:89175219-89175241 GAATTTGACTGAGGGGCATAAGG - Intergenic
977867769 4:102050206-102050228 GAATTCAGCTGAGGGGCATAAGG - Intronic
977869204 4:102070066-102070088 GAATTTGACAGAGGGGCATAAGG + Intronic
978262513 4:106777758-106777780 TAATATTTGTGAAGGGCATAAGG - Intergenic
978415508 4:108471516-108471538 TAATTTTTGTGAAGGGTATAAGG - Intergenic
978938577 4:114410217-114410239 GAATTTGACTGAAGGGCATAAGG + Intergenic
978979337 4:114922624-114922646 GAATTTGACCAAGGGGCATAAGG - Intronic
979056126 4:115997421-115997443 GAATTTGACTGACGGGCATAAGG + Intergenic
979065205 4:116122871-116122893 GAATGCGACTGAGGGGCATAAGG + Intergenic
979803292 4:124938430-124938452 GAATTCGACTGAGGGCCATAAGG - Intergenic
979940150 4:126752205-126752227 GAATTCGACTGAGGAGCATAAGG + Intergenic
980160116 4:129150680-129150702 GCATTTGACTGAGGGGCGTAAGG - Intergenic
980798418 4:137715100-137715122 GATTTTGACTGAGGGGCATAAGG - Intergenic
981447921 4:144861851-144861873 GAATTCGACTGAGTGGCATAAGG + Intergenic
981696058 4:147559993-147560015 GAAACTGTGTGCAGGGCATATGG + Intergenic
982103746 4:151993591-151993613 GCATTTGACTGAGGGGCATAAGG + Intergenic
983038687 4:162898615-162898637 GAATTTGACTGAGGGGCATAAGG + Intergenic
983406309 4:167335468-167335490 GAATTTGACTGAGGGGCATAAGG + Intergenic
983713031 4:170743491-170743513 GAATTTGAATGAGGGACATAAGG + Intergenic
983904909 4:173172017-173172039 GAATTTATTGGAGGGGCATAAGG + Intronic
984084479 4:175291986-175292008 GAAATTGACTGAGGGGCATAAGG + Intergenic
984113092 4:175644309-175644331 GAATTCAACTGAGGGGCATAAGG - Intronic
984918659 4:184744995-184745017 GAATTTGACCAAGGGGCATAAGG - Intergenic
985835499 5:2269242-2269264 GAATTTGTATAAGGAGTATAAGG - Intergenic
986219237 5:5752488-5752510 GAATTCAACTGAGGGGCATAAGG - Intergenic
986454596 5:7903688-7903710 GAATTCAACTGAGGGGCATAAGG + Intronic
986476784 5:8142652-8142674 GAATTCGACTGAGAGGCATAAGG + Intergenic
986538073 5:8813512-8813534 GAATTTGACTGCAGGGCATATGG - Intergenic
986751640 5:10792985-10793007 GAATTTGACTGAGAGGCATAAGG - Intergenic
986977135 5:13408071-13408093 GGATTTGACTGAGGGGCAGAAGG + Intergenic
986977805 5:13412580-13412602 GAATTTGACTGAGGGGCATAAGG - Intergenic
987620248 5:20330919-20330941 GAATTTGTTTGGGGGACATAAGG - Intronic
987655012 5:20796203-20796225 GAATTTGACTGAGGAGCATAAGG - Intergenic
988131169 5:27108226-27108248 GAATTTGACTGAGGGGCATAAGG + Intronic
988242616 5:28633173-28633195 GAAATTGACTGAGAGGCATAAGG - Intergenic
988244584 5:28663256-28663278 CAATTTTTGTGAAGGGTATAAGG - Intergenic
988768551 5:34407699-34407721 GAATTTGACTGAGGAGCATAAGG + Intergenic
989183753 5:38603264-38603286 GAATTCAACTGAGGGGCATAAGG - Intronic
989785971 5:45330061-45330083 AAAATTGTGTAAGGGGCACATGG - Intronic
989999828 5:50879903-50879925 GAATTTGACTGAAAGGCATAAGG - Intergenic
990018581 5:51097963-51097985 GAATTCCACTGAGGGGCATAAGG + Intergenic
990114280 5:52369284-52369306 GAATTTGACTGAGGGGCATAAGG + Intergenic
990213126 5:53502063-53502085 GAATTTGACTGAGGGGCATAAGG + Intergenic
990318054 5:54602564-54602586 GAATTAGACTGAGGGGCATAAGG + Intergenic
990576104 5:57125018-57125040 GAAGTTGGGTGATGGGCACATGG - Intergenic
990766234 5:59186324-59186346 GAATTGTTGTGAGGAGTATATGG + Intronic
990896109 5:60701418-60701440 GAGTTCGACTGAGGGGCATAAGG + Intergenic
991119128 5:62990669-62990691 TAATTTTTGTGACGGGTATAAGG + Intergenic
991561007 5:67952666-67952688 TAATTTTTGTGAAGGGTATAAGG + Intergenic
991657620 5:68919900-68919922 GAATTTGACTGAGAGGCATAAGG + Intergenic
991686351 5:69185747-69185769 GGATTTGACTGAGGGGCATAAGG + Intergenic
992399123 5:76395545-76395567 GAATTCGACTGAGGGGCATAAGG - Intergenic
992540318 5:77757972-77757994 GAATTCGACTGAGGGGTATAAGG + Intronic
992697854 5:79308383-79308405 TAATTTTTGTGAAGGGTATAAGG + Intronic
993177255 5:84502726-84502748 CAATTTGACTGAGGGGCAGAAGG + Intergenic
993364865 5:87022829-87022851 GAATTTGACTGAGCAGCATAAGG - Intergenic
993406992 5:87524304-87524326 GAATTTGACTGAGGCGCATAGGG + Intergenic
993724411 5:91351853-91351875 GAATTTGACTAAGGAGCATAAGG - Intergenic
994196575 5:96929274-96929296 GAATTCTGCTGAGGGGCATAAGG - Intronic
994281437 5:97908179-97908201 GAATTTGGCTGAGGGGCATAAGG - Intergenic
994754017 5:103772832-103772854 AAATTCGACTGAGGGGCATAAGG - Intergenic
995130053 5:108620568-108620590 GAATTTGACGGAGGGGCATAAGG + Intergenic
995191400 5:109322450-109322472 GAATTTGACTGAGGGGCATAAGG - Intergenic
995482898 5:112610405-112610427 GAATTCAACTGAGGGGCATAAGG - Intergenic
996151132 5:120036213-120036235 GAATTCAACTGAGGGGCATAAGG - Intergenic
996281788 5:121739062-121739084 GAATTCAACTGAGGGGCATAAGG + Intergenic
996567690 5:124897418-124897440 GAATTTCACAGAGGGGCATATGG - Intergenic
996685901 5:126280360-126280382 GAATGAGTGTTAGGGGAATAAGG - Intergenic
996953383 5:129155018-129155040 GAATTTGACTGAGGGGCATAAGG + Intergenic
996998130 5:129724474-129724496 GAATTTGACTGAGAAGCATAAGG + Intronic
998172318 5:139879914-139879936 GTTTTTGTCTGAGGGTCATAGGG + Intronic
998571924 5:143268126-143268148 TAATTTTTGTGAAGGGCATAGGG + Intergenic
998796094 5:145820703-145820725 GAATTCGACTGAGGGGCATAAGG + Intronic
998932272 5:147194411-147194433 GAAGCTGTGTGAGGGTCAGAGGG + Intergenic
1000766576 5:165299132-165299154 GAATTTGACCGAGGGGCATAGGG + Intergenic
1001530100 5:172455285-172455307 GACTATGTGTGAGGGGCAGCTGG + Intergenic
1003077111 6:2992293-2992315 GAAACTGTGTTAGGGGAATATGG - Intronic
1003166414 6:3682844-3682866 GAAACTGGGTGAGGGGTATAGGG - Intergenic
1003201897 6:3969140-3969162 GAATTTGGCTGAGGGGCATAAGG + Intergenic
1004499115 6:16193067-16193089 GAATTTGGGTAAAGGGAATAGGG - Intergenic
1004619970 6:17323589-17323611 TATGTTGTGTGAGGGGCTTAGGG + Intergenic
1005621345 6:27623450-27623472 TAATTTGTCCGAGGGGCATAAGG + Intergenic
1005812157 6:29525904-29525926 GAATTCGACTGAGGGGCATACGG + Intergenic
1006017994 6:31097745-31097767 GAATTTGACTGAGGGGCATAAGG - Intergenic
1007000504 6:38307825-38307847 GCATGTGTTTGAGGGGCAAAAGG - Intronic
1007163571 6:39812023-39812045 GAATTTGTATCTGGGGCATAGGG + Intronic
1007180492 6:39926056-39926078 GATTGTGTGTGTTGGGCATAGGG - Intronic
1007847178 6:44768980-44769002 GAATTCAACTGAGGGGCATATGG + Intergenic
1008768783 6:54952916-54952938 GTGTTTGTGTGAAGGGCATGGGG + Intergenic
1009401551 6:63262295-63262317 GAATTTGACTGAGGAGCATAAGG + Intergenic
1009560282 6:65232572-65232594 GAAACTGGGTGAGGGGTATATGG - Intronic
1009684007 6:66932984-66933006 GAATATGACTGCGGGGCATAAGG - Intergenic
1010105951 6:72168248-72168270 GAATTTGACTGAGGGGTTTAAGG + Intronic
1010977294 6:82330047-82330069 GAATTCGACTGAGGGGCATAAGG - Intergenic
1011314046 6:86011545-86011567 GAATTCGACTGAGGGCCATAAGG - Intergenic
1012000230 6:93645186-93645208 GAATCTGACTGAGGAGCATAAGG - Intergenic
1012446849 6:99315483-99315505 GGCTTTTTGTGAGGGGCTTAAGG - Intronic
1013352904 6:109321739-109321761 GAATGTGTGTGAGGACCTTATGG + Intergenic
1013470472 6:110459715-110459737 GAAACTGGGTGAGGGTCATATGG + Intronic
1013631155 6:111987421-111987443 GATTTTGTGTAAGGAGCAGAAGG - Intergenic
1013968426 6:115984720-115984742 GACTTTGTGTGAATGGCAGAGGG - Intronic
1014015456 6:116525069-116525091 GAATTTGTGTGATGGAAATTAGG - Intronic
1014738357 6:125121178-125121200 GAATTCGACTGAGGGACATAAGG + Intronic
1014768383 6:125433724-125433746 GAATTTGACCAAGGGGCATAAGG + Intergenic
1015580067 6:134714651-134714673 GAATTCGACTAAGGGGCATAAGG + Intergenic
1015789053 6:136948154-136948176 TAATTTTTGTGAGGAGTATAAGG - Intergenic
1015824856 6:137300793-137300815 GAATTTGACTGAGGGGCATAAGG + Intergenic
1016126707 6:140412397-140412419 GACTTTGATTGAGGGGCATAAGG - Intergenic
1016727510 6:147392168-147392190 GAATTGGGGTGAGAGGCATGGGG - Intergenic
1017106222 6:150890659-150890681 GAATTGGACTGAGGGCCATAAGG + Intronic
1017426974 6:154332049-154332071 GAATTTGGCTGAGGGGCATAAGG - Intronic
1017474833 6:154779879-154779901 GAAACTGAGTGAGGGGCACATGG - Intronic
1017821495 6:158052281-158052303 GAATCTGGGTGAAGGACATATGG - Intronic
1018134901 6:160769616-160769638 GAATTTGACTGAGGGGCATGAGG - Intergenic
1018664769 6:166125572-166125594 GAATTTGACCGAGGGGCACAGGG + Intergenic
1018845834 6:167554775-167554797 GAATTCGATTGAGGGGCCTAAGG + Intergenic
1018994060 6:168697465-168697487 GAATCTGAGTGAAGGGCACATGG + Intergenic
1019041640 6:169110755-169110777 GAATTCAACTGAGGGGCATAAGG + Intergenic
1019817733 7:3213429-3213451 GAATTCGACTGAGGGGCATAAGG - Intergenic
1020587292 7:10085092-10085114 GAATTTGACTGAGGAGCATGGGG + Intergenic
1020788459 7:12595953-12595975 GAATTCGACTGACGGGCATAAGG + Intronic
1020978948 7:15043985-15044007 TAAGTTGTCTGAGGGGCATAAGG + Intergenic
1021506381 7:21390034-21390056 GAATTTGACTGAGGAGCATAAGG - Intergenic
1023189973 7:37570014-37570036 GAATTCCACTGAGGGGCATAAGG + Intergenic
1023684308 7:42719049-42719071 GAATTTGTCTGAGGAGCATAAGG + Intergenic
1024239168 7:47420789-47420811 GAATTTGACTGAGGGATATAAGG - Intronic
1024707008 7:51971995-51972017 GAACTTTTATGATGGGCATAGGG + Intergenic
1025929640 7:65983322-65983344 GAATTGCACTGAGGGGCATAAGG + Intergenic
1026221721 7:68404328-68404350 GAATTTGACTGAGGGACGTAAGG + Intergenic
1026325895 7:69310221-69310243 GAAGTTGGGGGAGGGGAATATGG + Intergenic
1026352194 7:69527104-69527126 GAATTTGACTGAGGGGCATAAGG - Intergenic
1027596783 7:80184169-80184191 GAATTCGGCCGAGGGGCATAAGG + Intronic
1027616558 7:80431309-80431331 GAATTTGACTGAGGGGCATAAGG - Intronic
1028525856 7:91785886-91785908 GAAACTGGGTGACGGGCATATGG + Intronic
1029499424 7:100918947-100918969 TAATTCCTCTGAGGGGCATAAGG - Intergenic
1030060505 7:105617547-105617569 GAAATAGGGTGAGGGGCATGTGG + Intronic
1030257744 7:107529803-107529825 GAATTCGACTGAGGGGCATAAGG - Intronic
1030414795 7:109229678-109229700 GAATTTATCTGAGGGGCATAAGG + Intergenic
1030484232 7:110146334-110146356 AAATTTATCTGAGGGGCATATGG - Intergenic
1030515554 7:110533799-110533821 GAATTTGACTGAGAGGCATAAGG - Intergenic
1030769388 7:113455597-113455619 TAATTTTTGTGAAGTGCATAGGG - Intergenic
1030816843 7:114049328-114049350 GAATTTGGCTGAATGGCATAAGG - Intronic
1030825751 7:114155712-114155734 GAATTTGATTGAGGGGCATAAGG + Intronic
1030856927 7:114570050-114570072 GATTTTGTCTGAAGGGCAAAAGG - Intronic
1032371419 7:131356864-131356886 GAATTCGAATGAGGGGCATAAGG + Intronic
1034685621 7:152968364-152968386 GAATTTGACTGAGGGCCATAAGG - Intergenic
1034852665 7:154509921-154509943 GAATGGGGGTGAGGGGCATGGGG + Intronic
1035183572 7:157108480-157108502 GAATCAGTGAGTGGGGCATAAGG + Intergenic
1036625967 8:10471782-10471804 GAGTTTGACTGAGGGGCATAAGG + Intergenic
1037020157 8:13960139-13960161 GAATTCAACTGAGGGGCATAAGG + Intergenic
1037132874 8:15427673-15427695 GAATTTGACTGAGGGGCATAAGG - Intronic
1037135437 8:15454331-15454353 GAATTCAACTGAGGGGCATAAGG - Intronic
1037958561 8:23078151-23078173 GAATTCGACTGAGGGTCATAAGG + Intergenic
1037962460 8:23108072-23108094 GAACTGGTTTGAGGGGCATAAGG + Intronic
1037968976 8:23158222-23158244 GAATTGGACTGAGGGGCATAAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038025455 8:23584733-23584755 TAATTTTTGTAAAGGGCATAAGG + Intergenic
1038560980 8:28579791-28579813 GAATTTGTGTAAAGGACAAAAGG + Intergenic
1039095965 8:33885669-33885691 GAATTTGACTGAGGGGCATAAGG + Intergenic
1039165402 8:34673860-34673882 GAATTTGGGTGAGGTGTATTAGG + Intergenic
1039375476 8:37028435-37028457 GAATCTGGGTAAAGGGCATATGG - Intergenic
1039500061 8:38009581-38009603 GAATTCGACTGAGGGGCATAAGG - Intergenic
1039959213 8:42232824-42232846 GAATTTGACTGAGGGGCATAAGG + Intergenic
1040395977 8:47000698-47000720 GAATTTGTGTTAGGGCCATTGGG - Intergenic
1041086441 8:54261139-54261161 GAATCTGTGTAAGGGGTATACGG - Intergenic
1041351094 8:56948255-56948277 GAATTTGACCAAGGGGCATAAGG - Intergenic
1041377276 8:57217054-57217076 GAGTTTGACTGAGGGGCATGAGG + Intergenic
1041392021 8:57355284-57355306 GCATTTGTGTGACAGGGATAAGG + Intergenic
1041395654 8:57388309-57388331 AAATTTGACTGAGGGGCATAAGG - Intergenic
1041409734 8:57540430-57540452 GAATTTGTCCAAGGGACATAAGG + Intergenic
1041482814 8:58342440-58342462 GAATTTGACTGAGGGGCATAAGG + Intergenic
1041720782 8:60973495-60973517 GAATTCAACTGAGGGGCATAAGG + Intergenic
1041810453 8:61902754-61902776 GAATTTGACTGAGACGCATAAGG + Intergenic
1042565470 8:70105842-70105864 GCATTTGTGTTAGTGGGATATGG + Intergenic
1042917445 8:73889404-73889426 GAATTCAGTTGAGGGGCATAAGG - Intergenic
1043599582 8:81920673-81920695 GAATTCAACTGAGGGGCATAAGG - Intergenic
1043853456 8:85239912-85239934 GAATTTGACCAAGGGGCATAGGG - Intronic
1044003683 8:86916174-86916196 GAATTTGACTAAGGGGCATGAGG + Intronic
1044085512 8:87937772-87937794 GAATTCGACTGAGGGGCATAAGG - Intergenic
1044123357 8:88425607-88425629 GAATTTAACTGAGGGGCATAAGG - Intergenic
1045427762 8:102084328-102084350 TAATTTGACTGAGGGGCATAAGG + Intronic
1045646511 8:104304898-104304920 GAATTTGACCGAGAGGCATAAGG + Intergenic
1045919952 8:107518070-107518092 GAATTTGACCAAGGGGCATAAGG - Intergenic
1045977719 8:108148580-108148602 GAATTCGGCTGAGGGTCATAAGG + Intergenic
1046028257 8:108750974-108750996 GAATTTGACTAAGGGTCATAGGG - Intronic
1046184301 8:110692978-110693000 GAATTTGACTAAGGGGCATAAGG + Intergenic
1046255089 8:111686122-111686144 GAAGTTGTGGTAGGGGTATAAGG - Intergenic
1046386977 8:113518537-113518559 TAATTTGACTGAGGGACATAAGG - Intergenic
1047123959 8:121939216-121939238 GTATTTGTGTGGGGGGCAATAGG + Intergenic
1047152944 8:122285021-122285043 GAATTTGACGGAGGGGCATAAGG - Intergenic
1047871755 8:129090894-129090916 GAATTCAACTGAGGGGCATAAGG + Intergenic
1048117841 8:131545262-131545284 GAATTTGATTGAAGGGCATAAGG + Intergenic
1048128460 8:131663800-131663822 GAATTTGACTGAGGGGCATAAGG - Intergenic
1048726733 8:137394184-137394206 TAATTTTTGTGAAGGGTATAAGG + Intergenic
1050297563 9:4221261-4221283 GAATCTGGGTGAAGGGCATATGG + Intronic
1050397070 9:5210340-5210362 TAATTTGTGGGAGAGGCATTAGG + Intergenic
1050411336 9:5368931-5368953 GAATTTTTGTGTAAGGCATAAGG - Intronic
1050588623 9:7139850-7139872 TAATTTGACTCAGGGGCATAAGG + Intergenic
1051080548 9:13288772-13288794 GAATTAAACTGAGGGGCATACGG - Intergenic
1051972979 9:22913370-22913392 GAATGTGACTGCGGGGCATAAGG - Intergenic
1051991259 9:23154847-23154869 GAATTTGACTGAGGGCTATAAGG - Intergenic
1052160762 9:25255700-25255722 GAATTCGACCGAGGGGCATAAGG - Intergenic
1052424709 9:28289918-28289940 GAATTTGTATGAAGGGCATGGGG - Intronic
1052517593 9:29503264-29503286 GAATTCAACTGAGGGGCATAAGG + Intergenic
1053343959 9:37364357-37364379 GAATAGGTGTGCGGGGCATAGGG + Intergenic
1053451273 9:38196206-38196228 GAATTTGTCCAAGGGGCATAAGG - Intergenic
1054946340 9:70799821-70799843 GACTTAGTGTGAGGGTCAAATGG - Intronic
1055199694 9:73645659-73645681 GAATTTGATGGAGGGGCATAAGG + Intergenic
1055998768 9:82192273-82192295 GAATTCGACTGAGGGGCCTAAGG + Intergenic
1056435180 9:86569035-86569057 GAATTTGACTGAGGGGCCTAAGG + Intergenic
1057154360 9:92827569-92827591 GAATCTGTGTGAAGGATATATGG + Intergenic
1057876309 9:98757139-98757161 GAAGCTGTGTGAGGGGTATGTGG - Intronic
1058143436 9:101382657-101382679 GAATTCAACTGAGGGGCATAAGG - Intronic
1058174098 9:101718171-101718193 GACATTGTGTGAGGAGCACAGGG + Intronic
1058247855 9:102653189-102653211 GAATTTGACTGAGGGACATAAGG - Intergenic
1058278193 9:103074469-103074491 GAATTAGACTGAGAGGCATAAGG + Intergenic
1058300973 9:103372758-103372780 GAATTCGACCGAGGGGCATAAGG + Intergenic
1059479866 9:114580857-114580879 GAATTTGACCCAGGGGCATAAGG - Intergenic
1059793720 9:117668057-117668079 GAGTATGTGTCAGGGGCTTATGG + Intergenic
1059849406 9:118320595-118320617 GAATTGGACTGAGGGGCATGAGG + Intergenic
1060561458 9:124548214-124548236 GAATTTAGGTAAAGGGCATATGG + Intronic
1061107936 9:128546573-128546595 GAATCTGGGTGAAGGGTATATGG + Intergenic
1061527126 9:131175178-131175200 GAATTTGTGAGAGGGGATCAGGG + Intronic
1061766599 9:132885560-132885582 GAATCTGGGTGAGGGTTATATGG - Intronic
1062517955 9:136945492-136945514 GAAGTTGTGGGAGGGGTAGAGGG + Intronic
1062611848 9:137378987-137379009 GCATCTGTGTGAGGGGTACAAGG + Intronic
1062611887 9:137379121-137379143 GCATCTGTGTGAGGGGTACAGGG + Intronic
1062640505 9:137515916-137515938 GGATTTGGGGGAGGGGCATTGGG - Intronic
1185757508 X:2663414-2663436 GAATTTGACTGAGGGCCATAAGG - Intergenic
1185886738 X:3790006-3790028 GAATTTGACTGAAGGGCATAAGG - Intergenic
1186097039 X:6113293-6113315 GAATTTGAGGGTGGGGTATAAGG + Intronic
1186216214 X:7303879-7303901 AAATATGAGTGAAGGGCATATGG - Intronic
1187036428 X:15545190-15545212 GGATTCATCTGAGGGGCATAAGG + Intronic
1188015015 X:25098833-25098855 GAATCTGGGTGAAGGGTATATGG + Intergenic
1188284489 X:28311491-28311513 GAATTTGACTGAGGGGCATAAGG + Intergenic
1188752179 X:33918610-33918632 GAATTTGACTGAGGAGCACAAGG + Intergenic
1188881165 X:35493508-35493530 GAATTTGACCGAGGGGCATAAGG - Intergenic
1188883344 X:35518054-35518076 GAATTAGACTGAGGGGCATAAGG + Intergenic
1188898619 X:35700179-35700201 GAATTTGACTGAGGGGCATAGGG + Intergenic
1188953687 X:36408200-36408222 GAATTCGACTGAGGGGCATAAGG - Intergenic
1188989797 X:36803580-36803602 GAATTCTGCTGAGGGGCATAAGG - Intergenic
1189161961 X:38818492-38818514 ATATTTGGGTGAGGGGTATATGG + Intergenic
1189492470 X:41480933-41480955 GAATTTGTCCAAGGGGCATAAGG - Intergenic
1189742040 X:44129114-44129136 GAATCTGGGTGAAGGGGATACGG + Intergenic
1190417219 X:50191836-50191858 GAGTTTGGGGGAGGAGCATAGGG + Intronic
1190704250 X:53013284-53013306 GAATTTGACCAAGGGGCATAAGG + Intergenic
1190771862 X:53521463-53521485 GAATTTGACTGAGGGGTACAAGG + Intergenic
1191997651 X:67113639-67113661 GTATTTGTGTGAGGAGAATAGGG - Intergenic
1192537497 X:71940716-71940738 GAAATTGGGTGAGGGGGATGTGG + Intergenic
1192811889 X:74554383-74554405 GAATTCAACTGAGGGGCATAAGG + Intergenic
1193076774 X:77363542-77363564 GAATTTGTGAGGGGGTCACAGGG - Intergenic
1193330729 X:80232834-80232856 GCTTTTGACTGAGGGGCATAAGG + Intergenic
1193486146 X:82087208-82087230 GAATTTAACTGAGGGGAATATGG - Intergenic
1193518726 X:82503044-82503066 GAATTTGACTGAGGGGAATAAGG - Intergenic
1193583769 X:83295299-83295321 GAATTTGACTGAGGGGTATAAGG - Intergenic
1193731865 X:85111985-85112007 GAATTAGACTGAGGGGCATAAGG + Intergenic
1193864184 X:86709381-86709403 TAATTTTTGTGAAGGGCAGATGG - Intronic
1193974660 X:88102491-88102513 GAATTTGACTAAGGGGTATAAGG + Intergenic
1193994137 X:88344288-88344310 GAATTCAACTGAGGGGCATAAGG + Intergenic
1194170619 X:90575925-90575947 GAATTCAACTGAGGGGCATAAGG + Intergenic
1194234175 X:91361663-91361685 GAATATGAATGAGGGGCATAAGG + Intergenic
1194627594 X:96243657-96243679 GAATTTGACTGAGGGGCATAAGG + Intergenic
1194810610 X:98382952-98382974 GAATTTGACTGAGGGGCATAAGG - Intergenic
1195220433 X:102741120-102741142 GAATTTGACTGAGGGGCATAAGG + Intronic
1195256795 X:103098830-103098852 GAATTTGACTGAGGGGCATAAGG + Intergenic
1195258521 X:103111262-103111284 GAATTCAACTGAGGGGCATAAGG - Intergenic
1195617217 X:106921820-106921842 GAATTTGTCTTCTGGGCATAGGG - Intronic
1196287010 X:113894453-113894475 GAATTTGACTGAGGAGCATAAGG - Intergenic
1196373188 X:115001390-115001412 GAATTTGACTGAAGGGCATAAGG + Intergenic
1197837689 X:130712849-130712871 GAATTCGACTGAGGGGCATAAGG - Intronic
1197932247 X:131707924-131707946 GAATCCGACTGAGGGGCATAAGG - Intergenic
1198260001 X:134957284-134957306 TAATTTGGGTGAAGGGTATATGG - Intergenic
1198757902 X:140000497-140000519 CAATCTGACTGAGGGGCATAAGG + Intergenic
1198849215 X:140947692-140947714 GAATTTGTGTGTTGGGCAGGGGG + Intergenic
1198957791 X:142150672-142150694 TAATTTGACTGAGGGGCATAAGG - Intergenic
1199347318 X:146756911-146756933 GAATTCGACGGAGGGGCATAAGG + Intergenic
1199702589 X:150394092-150394114 TAATTTTTGTGAGGGGTGTAAGG + Intronic
1200841224 Y:7783630-7783652 GGATTAGGGTGAGGGGAATAAGG - Intergenic
1201634956 Y:16112423-16112445 GAATTTGCCTTAGGTGCATAAGG - Intergenic
1201910023 Y:19124521-19124543 GAATTTGACTGAGAGGCATAAGG + Intergenic
1202085761 Y:21135094-21135116 GTATTTGTCTGAGGCACATAAGG - Intergenic