ID: 972416183

View in Genome Browser
Species Human (GRCh38)
Location 4:38842686-38842708
Sequence ATGGCCACCCAGCTCCGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972416176_972416183 14 Left 972416176 4:38842649-38842671 CCTCTGTGTGCCAGCACACAAGG 0: 1
1: 0
2: 1
3: 11
4: 203
Right 972416183 4:38842686-38842708 ATGGCCACCCAGCTCCGACAGGG 0: 1
1: 0
2: 0
3: 12
4: 122
972416180_972416183 -9 Left 972416180 4:38842672-38842694 CCAGACAAGTCTCCATGGCCACC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 972416183 4:38842686-38842708 ATGGCCACCCAGCTCCGACAGGG 0: 1
1: 0
2: 0
3: 12
4: 122
972416175_972416183 22 Left 972416175 4:38842641-38842663 CCAGAATGCCTCTGTGTGCCAGC 0: 1
1: 0
2: 1
3: 30
4: 189
Right 972416183 4:38842686-38842708 ATGGCCACCCAGCTCCGACAGGG 0: 1
1: 0
2: 0
3: 12
4: 122
972416178_972416183 4 Left 972416178 4:38842659-38842681 CCAGCACACAAGGCCAGACAAGT 0: 1
1: 0
2: 1
3: 14
4: 148
Right 972416183 4:38842686-38842708 ATGGCCACCCAGCTCCGACAGGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972416183 Original CRISPR ATGGCCACCCAGCTCCGACA GGG Intronic
900648033 1:3717835-3717857 GAGGCCACCCAGCTCCGGCCCGG + Intronic
900737539 1:4308645-4308667 ACGGCCACACAGCCCCAACATGG - Intergenic
900882986 1:5395115-5395137 ATGGCCACCAAGCTTCCATAGGG - Intergenic
901205973 1:7496113-7496135 ATGGCCACACAGCTCTGAGCCGG - Intronic
902635576 1:17733064-17733086 AAGGCCACACAGCTAGGACATGG + Intergenic
903665085 1:25001293-25001315 ATGGCAACCCAGCACCGGCCAGG - Intergenic
904303564 1:29572041-29572063 ATGGCCACACAGCTCAGAAGTGG - Intergenic
904350271 1:29900697-29900719 TTGGCCTCCCAGCTCAGTCATGG + Intergenic
904445636 1:30571166-30571188 TTGGCCTCCCAGCTCAGTCAAGG + Intergenic
915832996 1:159148183-159148205 ATGGCCAGCCAGCCCTGAGAAGG + Intergenic
916740906 1:167646255-167646277 ATGACCACCCAGCTGCGCCTTGG - Intronic
919918569 1:202154193-202154215 ATGCTCACTCAGCTCCGAGAGGG - Exonic
920370844 1:205478360-205478382 AGGGCCACCCAACTACTACAGGG + Intergenic
921313439 1:213868680-213868702 AGGGCCAACCAGCTCACACATGG + Intergenic
1067165848 10:43865958-43865980 CTGGCCATCCAGCTATGACAGGG + Intergenic
1068961231 10:62868777-62868799 ATTCCCACCCAGCTCTGAGATGG + Intronic
1070501023 10:77072489-77072511 CTGTCCAGCCAGCTCTGACAAGG + Intronic
1070764244 10:79047404-79047426 AAGGCCACCCACCTCCCACCAGG - Intergenic
1077167668 11:1151071-1151093 AGGGCCACCCAACCCCGCCATGG + Intergenic
1079712703 11:23707233-23707255 ATCACCCCCCAGCTCCAACAAGG + Intergenic
1084149709 11:67282414-67282436 ATGGCCCCCTTGCTCCCACAGGG + Exonic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1089052559 11:115558357-115558379 ATTGCCTCCCAGTTCCTACAGGG - Intergenic
1094574592 12:31673566-31673588 ATAGCCACCCAGCTTTGTCATGG - Intronic
1097457637 12:59819713-59819735 ATGGCCACCCAGCACACACATGG + Intergenic
1100713005 12:97277219-97277241 ATGACCACCCACCTGCCACAGGG - Intergenic
1101849105 12:108388151-108388173 ATGCCCACCCACCTCCGGAAGGG + Intergenic
1107552733 13:41492472-41492494 AAGGTCACCCAGCTACTACAAGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1111783949 13:92764095-92764117 ATGGCTACTCAGCTCAGCCAAGG + Intronic
1112078224 13:95936456-95936478 CTGGCCTCCCTGCTCAGACATGG + Intronic
1113890108 13:113731224-113731246 ATGGCCCCCGAGCTCCTGCAGGG + Exonic
1117152066 14:52899667-52899689 ATGGCTACCCAGTTCCAATATGG - Intronic
1121262647 14:92577684-92577706 AAAGCCACCCAGCTGCGACGAGG - Intronic
1121498539 14:94415050-94415072 AGGGCCACCCAGCTAGGACGTGG + Intergenic
1122575082 14:102737057-102737079 AGGGTCACTCAGCTCCTACACGG + Intergenic
1124873880 15:33572532-33572554 ATGGCAAAACAGCTCCAACAGGG - Intronic
1129878159 15:78990444-78990466 GGGGCCACACAGCTGCGACAAGG - Intronic
1131854500 15:96579161-96579183 ATGGTCACCCAGCTAGGAAATGG + Intergenic
1132839851 16:1973712-1973734 CTGGCCACCCACCGCCGGCAGGG + Intronic
1137684103 16:50373911-50373933 AAGGCCAGCCACCTCCCACAGGG - Intergenic
1141672820 16:85501813-85501835 ATGGGAACCCAGCCCCGACAGGG + Intergenic
1142184370 16:88687411-88687433 AAGGCCACCCAGCTCTGAGGTGG - Intergenic
1144702989 17:17350875-17350897 ATGGACACCCTGCACAGACAGGG - Intergenic
1146567225 17:33923901-33923923 ATGCCCACCCAGCAACTACATGG + Intronic
1146569473 17:33940299-33940321 CTGGCCAACCAGCTTCTACAGGG - Intronic
1146917247 17:36686142-36686164 ATGGTCACACAGCTGCGAAAGGG - Intergenic
1147679023 17:42227626-42227648 AAGGCCACCCAGCTCCTGGAGGG - Exonic
1147716118 17:42509831-42509853 CTGGCCACCCAGCTCACTCAGGG + Intronic
1150838945 17:68590486-68590508 ATGGGGACCCAGCTCCTTCACGG - Intronic
1157623427 18:49029200-49029222 AGGGCCACCCAGCTGGGACTTGG + Intergenic
1160033010 18:75278697-75278719 TTGGCCACTCAGCTGTGACAGGG + Intronic
1162823613 19:13237785-13237807 CTGGCCACCCAGCTCCACCTGGG + Intronic
1163386147 19:17001711-17001733 ATGGCCTCCCTGCTCCCACAAGG - Intronic
1164643200 19:29841328-29841350 GTGGCCACCCAGCTCACAGATGG - Intergenic
1167643986 19:50695918-50695940 AGGACCGCCCAGCTCCGGCAGGG + Intronic
1167661152 19:50796797-50796819 ATGACCACCCAGCTCCTCTAGGG - Intergenic
925686929 2:6482429-6482451 GTGGCCAGCCAGGTCCAACAGGG + Intergenic
927205068 2:20603813-20603835 ATGGGAACCCAGGTCCTACATGG + Intronic
927484208 2:23477752-23477774 ATGGCATCCCCGCTCCTACACGG + Intronic
928242844 2:29601581-29601603 ATGGCCACCCAGAGAGGACAGGG + Intronic
934576685 2:95406164-95406186 ATAGACTCCCAGCTCCTACAAGG + Intronic
934638907 2:96014332-96014354 ATAGACTCCCAGCTCCTACAAGG + Intergenic
934794744 2:97091079-97091101 ATAGACTCCCAGCTCCTACAAGG - Intronic
936463285 2:112726735-112726757 CTCGCCACCCAGCTCCCACCTGG - Exonic
938633473 2:133195967-133195989 CCGGCCACCCAGCACCCACAAGG + Intronic
947858114 2:233338251-233338273 ATGGCCACAGAGCTCAGAGAAGG + Intronic
948616620 2:239203239-239203261 GTGCCCACCCAGCACAGACAAGG + Intronic
1175584371 20:60126312-60126334 ATGGCCACTCAGCATCCACATGG + Intergenic
1175777282 20:61661225-61661247 CTGGCCTCCCAGCTCCCAGACGG - Intronic
1175908638 20:62394116-62394138 GTGGACACCCAGCGCCGTCAGGG - Intronic
1176118988 20:63445708-63445730 AGGGCCTCCCAGCTCAGACAGGG - Intronic
1176118993 20:63445727-63445749 AGGGCCTCCCAGCTCAGACAGGG - Intronic
1176118999 20:63445746-63445768 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119005 20:63445765-63445787 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119010 20:63445784-63445806 AGGGCCTCCCAGCTCAGACAGGG - Intronic
1176119016 20:63445803-63445825 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119021 20:63445822-63445844 AGGGCCTCCCAGCTCAGACAGGG - Intronic
1176119027 20:63445841-63445863 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119033 20:63445860-63445882 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119038 20:63445879-63445901 AGGGCCTCCCAGCTCAGACAGGG - Intronic
1176119044 20:63445898-63445920 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119050 20:63445917-63445939 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119055 20:63445936-63445958 AGGGCCTCCCAGCTCAGACAGGG - Intronic
1176119061 20:63445955-63445977 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119067 20:63445974-63445996 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119073 20:63445993-63446015 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1176119097 20:63446076-63446098 AGGGTCCCCCAGCTCAGACAGGG - Intronic
1178376785 21:32073920-32073942 ATGGCCGCCCTCCTCCCACATGG + Intergenic
1180021696 21:45132558-45132580 GTGCCCACCCAGCCCCCACAAGG - Intronic
1180027858 21:45178525-45178547 AGGGCCACCCGGGTCCTACAAGG - Intronic
1180257751 21:46644604-46644626 GTAGCCACTCAGCTCTGACATGG + Intronic
1182273316 22:29169605-29169627 ATGGCTACCCAGCTGTGGCAGGG - Intergenic
1185215122 22:49594367-49594389 CTGGCCCCCCAGCTCCCTCAGGG + Intronic
952886519 3:38015805-38015827 ATGGCCTCCCAACTCCCAGAGGG + Intronic
953483764 3:43275136-43275158 ATGCCACCCCAGCTCCAACAAGG - Intergenic
955051072 3:55411573-55411595 ATGGCCACCCAGCCAAGTCAGGG + Intergenic
961722781 3:128907491-128907513 AGGACCACCCAGCTCCGAGCAGG - Intronic
967043612 3:185716722-185716744 ATGACCAGCCAGCGCTGACAGGG - Exonic
968861565 4:3175596-3175618 AGAGCCACACAGCTCCCACATGG - Intronic
969334705 4:6500843-6500865 ATGAACACCCAGCTCCCTCAGGG - Intronic
970193605 4:13536299-13536321 CTGGCCACCCAGAGCCGACCCGG - Intergenic
971850228 4:31976010-31976032 ATGGCCACCCAGCTGTCAAATGG + Intergenic
972416183 4:38842686-38842708 ATGGCCACCCAGCTCCGACAGGG + Intronic
972776138 4:42242516-42242538 ATGGCCACCCAGCTAGTAGAAGG - Intergenic
973532884 4:51850837-51850859 ATGGCCCCTCAGCTCCATCAGGG - Intronic
983862176 4:172720705-172720727 AAGGCCACTCAGATCCTACAGGG - Intronic
985956696 5:3271066-3271088 GTGGCCACCCAGCACGGCCAGGG + Intergenic
992758383 5:79930489-79930511 GTAGCCACCCAGCTCCCACATGG - Intergenic
998728437 5:145045577-145045599 ATGGACACCCAGCTTCCACCTGG + Intergenic
1001730803 5:173955058-173955080 GGTGCCACCCAGCTCTGACAAGG - Intronic
1005997638 6:30940981-30941003 GCAGCCACCCAGCTCCGACATGG + Exonic
1006429991 6:33989451-33989473 ATGGCCACATAGCTCAGACGAGG - Intergenic
1006710523 6:36065356-36065378 ATGGCCACCTAACCCAGACATGG + Intronic
1007173515 6:39880869-39880891 ATGGCCACAGAGCACCCACAGGG - Intronic
1014068739 6:117156918-117156940 TTGGCCACCCAGCTGGGACTTGG - Intergenic
1015208160 6:130665629-130665651 ATTGCCTCTCAGCTCCTACATGG + Intergenic
1017395365 6:153992414-153992436 ATGGCCTACCAGATCCTACATGG + Intergenic
1019016120 6:168880727-168880749 AAGGTCACCCAGCTCTGCCAAGG - Intergenic
1019623077 7:2002083-2002105 CTGGCCTCCCAGCTCCTCCAGGG + Exonic
1019756802 7:2776685-2776707 TTGGCCACCCTGCTCCCACTTGG + Intronic
1020397823 7:7737004-7737026 ATGGCCACCTTGCTCTGAGAGGG + Intronic
1028091737 7:86711036-86711058 AAGGCCACACAGCTACTACATGG - Intronic
1039968983 8:42305738-42305760 GTGGCCACCCGGCTCAGACGTGG + Intronic
1045653977 8:104367930-104367952 AAGGCCACCCAGCTTAGAAAGGG + Intronic
1046116959 8:109796312-109796334 ATATCTACCCAGCTCTGACACGG - Intergenic
1048246598 8:132809756-132809778 ATGGCCACCCTGCTCATAAAAGG - Intronic
1059261944 9:112985536-112985558 ATGGCCACCCAGCTTCTAAATGG - Intergenic
1060522540 9:124301790-124301812 ACGGTCACCCAGCTCCGAAGTGG - Intronic
1060933717 9:127504324-127504346 AAGGCCACCCAGCTCCTGCCTGG - Intergenic
1062399762 9:136367245-136367267 ATGACCACAGAGCTCCGACCTGG - Exonic
1062475142 9:136722984-136723006 CTGGCCAACCAGCGCCGGCAGGG - Exonic
1199170150 X:144726119-144726141 ACGGCCTCTCAGCTCCCACACGG + Intergenic
1200253241 X:154564809-154564831 GCGGCCACCCAGCTCTGCCAGGG - Exonic
1200264526 X:154639606-154639628 GCGGCCACCCAGCTCTGCCAGGG + Intergenic