ID: 972416612

View in Genome Browser
Species Human (GRCh38)
Location 4:38847251-38847273
Sequence ACTTTAACAGGAATGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972416612_972416620 6 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416620 4:38847280-38847302 CAAGAATGCACACATTAGGGGGG 0: 1
1: 0
2: 2
3: 13
4: 235
972416612_972416624 30 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416624 4:38847304-38847326 TGGTTCCAAGATGGCCAAATAGG 0: 50
1: 292
2: 774
3: 1530
4: 3120
972416612_972416619 5 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416619 4:38847279-38847301 TCAAGAATGCACACATTAGGGGG 0: 1
1: 0
2: 1
3: 8
4: 170
972416612_972416621 7 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416621 4:38847281-38847303 AAGAATGCACACATTAGGGGGGG 0: 1
1: 0
2: 1
3: 13
4: 210
972416612_972416618 4 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416618 4:38847278-38847300 ATCAAGAATGCACACATTAGGGG 0: 1
1: 0
2: 2
3: 14
4: 178
972416612_972416623 21 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416623 4:38847295-38847317 TAGGGGGGGTGGTTCCAAGATGG 0: 1
1: 2
2: 21
3: 136
4: 494
972416612_972416622 10 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416622 4:38847284-38847306 AATGCACACATTAGGGGGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 148
972416612_972416616 2 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416616 4:38847276-38847298 ACATCAAGAATGCACACATTAGG 0: 1
1: 0
2: 2
3: 17
4: 197
972416612_972416617 3 Left 972416612 4:38847251-38847273 CCCCAAGGCATTCCTGTTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 174
Right 972416617 4:38847277-38847299 CATCAAGAATGCACACATTAGGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972416612 Original CRISPR ACTTTAACAGGAATGCCTTG GGG (reversed) Intronic