ID: 972417445

View in Genome Browser
Species Human (GRCh38)
Location 4:38855716-38855738
Sequence CAGGGTATGAACGCCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972417445_972417448 -9 Left 972417445 4:38855716-38855738 CCTCCAGAGGCGTTCATACCCTG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 972417448 4:38855730-38855752 CATACCCTGAGGCAGTTCCTAGG 0: 1
1: 0
2: 1
3: 43
4: 473
972417445_972417449 -8 Left 972417445 4:38855716-38855738 CCTCCAGAGGCGTTCATACCCTG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 972417449 4:38855731-38855753 ATACCCTGAGGCAGTTCCTAGGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972417445 Original CRISPR CAGGGTATGAACGCCTCTGG AGG (reversed) Intronic
904539374 1:31222494-31222516 CAGGGTATGGACCCATCTGGGGG + Intronic
913187289 1:116380448-116380470 ATGGGTATGAAGGCCTTTGGCGG + Intronic
915221557 1:154379130-154379152 CACGGTATGGACCCCTCTGTAGG + Intergenic
915671372 1:157491669-157491691 CGGGGTATGAAGGTCTCTGAAGG - Intergenic
917816733 1:178718256-178718278 CAGGGTATGAAAGAGTCTGTGGG + Intergenic
919026155 1:192172791-192172813 TAGGGCATGAACACCTTTGGAGG + Intronic
922856059 1:228775545-228775567 CAGGGCATGGACATCTCTGGGGG + Intergenic
1065522881 10:26589075-26589097 CAGGCTGTGGATGCCTCTGGGGG - Intergenic
1065527902 10:26641094-26641116 CAGGCCTTGAATGCCTCTGGGGG - Intergenic
1065528805 10:26648346-26648368 CAGGCTGTGGATGCCTCTGGGGG - Intergenic
1065558098 10:26936652-26936674 CAGGCTGTGGATGCCTCTGGGGG + Intergenic
1076817392 10:132921609-132921631 CAGGGTATGACCTTCTTTGGAGG + Intronic
1079981210 11:27153391-27153413 CAGGGAATGAACAGCTCTTGTGG + Intergenic
1083159690 11:60847502-60847524 CCGGGTGTGAATGCCTCTGGAGG - Intronic
1088718056 11:112566175-112566197 CTGGGTATTAAGGCCTCTTGAGG + Intergenic
1088977480 11:114828704-114828726 TAGAGTATGAACTCTTCTGGTGG - Intergenic
1089399495 11:118156289-118156311 CAGTGTAAGAGCGGCTCTGGAGG - Intergenic
1094156963 12:27347359-27347381 AAGGCTTTGAATGCCTCTGGTGG - Intronic
1099585602 12:84508705-84508727 AAGGGTTTGAATGCCTCTAGTGG + Intergenic
1104676369 12:130714755-130714777 CAGGGTCTGACCGGCTCCGGAGG - Intronic
1106138784 13:26993637-26993659 CAGGGGATGAAGGCCTCTGTCGG + Intergenic
1118454014 14:65929186-65929208 AAGGCTTTGAAGGCCTCTGGAGG + Intergenic
1122814868 14:104307401-104307423 AGGGGTATGAATGCCCCTGGTGG + Intergenic
1129318633 15:74761638-74761660 CAGGGTATGGCTACCTCTGGTGG - Intergenic
1130874306 15:87999047-87999069 CAGGGTATGAAAGGCTCCTGTGG + Intronic
1132765201 16:1530990-1531012 CTGGGTCTGGACGCTTCTGGCGG - Intronic
1135068390 16:19331053-19331075 CAGGCTATGGAGGCCTTTGGTGG - Intergenic
1138095089 16:54205242-54205264 CAGGTTATGGAGGCCTCAGGAGG + Intergenic
1141282946 16:82645238-82645260 TAGAGAATGAAAGCCTCTGGGGG + Intronic
1153076511 18:1167620-1167642 CAGGATATGAACCTCTTTGGGGG - Intergenic
1158535640 18:58305975-58305997 CTGGGTATAAAAGCCACTGGAGG - Intronic
1159169746 18:64750591-64750613 CAGAGTTTCAATGCCTCTGGTGG + Intergenic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1168785719 20:538408-538430 CAGGGTATGAAAGACTTTAGAGG - Intronic
1173342206 20:42162664-42162686 CAGGGTCTGAAAACATCTGGGGG - Intronic
1176322194 21:5340331-5340353 GAGGGCATTAAGGCCTCTGGTGG + Intergenic
1176479851 21:7272117-7272139 GAGGGCATTAAGGCCTCTGGTGG + Intergenic
1178924997 21:36767361-36767383 CAGGGTTTGCATGCATCTGGGGG + Intronic
1180398256 22:12379170-12379192 GAGGGCATTAAGGCCTCTGGTGG + Intergenic
952273682 3:31857097-31857119 GGGGGTATGAATGCCACTGGAGG - Intronic
963119587 3:141764818-141764840 CAGGGTGGGAAATCCTCTGGAGG - Intergenic
968923683 4:3535874-3535896 CAGGGGATGGAGCCCTCTGGAGG + Intergenic
972417445 4:38855716-38855738 CAGGGTATGAACGCCTCTGGAGG - Intronic
973903066 4:55497437-55497459 CAGGATATGAACCTCTCTGAAGG + Intronic
976461758 4:85320334-85320356 CAGGGAAGGAAAGCCTCTGTGGG + Intergenic
987331279 5:16859828-16859850 CAGGGAGTGAACAGCTCTGGGGG - Intronic
987710119 5:21494500-21494522 CAGGGTGGCTACGCCTCTGGGGG + Intergenic
988749492 5:34179662-34179684 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
991737752 5:69642866-69642888 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
991760441 5:69913559-69913581 CAGGGTGGCTACGCCTCTGGGGG + Intergenic
991786890 5:70204542-70204564 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
991789328 5:70222592-70222614 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
991814078 5:70497702-70497724 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
991817211 5:70518994-70519016 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
991839672 5:70788610-70788632 CAGGGTGGCTACGCCTCTGGGGG + Intergenic
991879336 5:71204932-71204954 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
991881776 5:71222961-71222983 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
993013572 5:82510668-82510690 CAGGGTGTGGACGCATCTGGGGG + Intergenic
993483150 5:88449720-88449742 CAGGGCATGAACACCTTTAGGGG - Intergenic
994460296 5:100062931-100062953 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
994484441 5:100376348-100376370 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
997811993 5:136979454-136979476 CGAGGTATGAAGGCCCCTGGGGG + Exonic
998411744 5:141916355-141916377 CAGGGTTTGGAGGCTTCTGGGGG + Intergenic
1001428327 5:171639774-171639796 CATGTTTTGAAGGCCTCTGGTGG + Intergenic
1002542362 5:179914613-179914635 GAGGGTATGCATGCCTGTGGGGG + Intronic
1005547565 6:26886012-26886034 CAGGGTGGCTACGCCTCTGGGGG - Intergenic
1008416745 6:51249546-51249568 CAGGGTATGGACGTCTTTAGGGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1024964176 7:55006733-55006755 CAGGTTATGCAAGCCTATGGCGG + Intergenic
1027151509 7:75737303-75737325 GAGGGGATGAAGTCCTCTGGGGG + Intronic
1032431408 7:131864894-131864916 CAGGTTCTGATCTCCTCTGGAGG + Intergenic
1033451187 7:141463593-141463615 CAGGGTTTGAAAACCACTGGGGG + Intronic
1045482094 8:102600844-102600866 CAGGGAGTGAACGCGTCGGGAGG - Intergenic
1047219991 8:122911364-122911386 GAGGGTGTGAAGGCCTCTGCAGG - Intronic
1049038863 8:140097691-140097713 CAGGGTAAGAACGCCTGTCTGGG + Intronic
1049394630 8:142394166-142394188 GAGGGTATGGAGGCCACTGGAGG - Intronic
1051364250 9:16309836-16309858 CTCGGTGTGAAGGCCTCTGGGGG + Intergenic
1051891197 9:21944785-21944807 CAGAGTGTGAATTCCTCTGGGGG - Intronic
1053799394 9:41754896-41754918 CAGGGGATGGAGCCCTCTGGAGG + Intergenic
1054145822 9:61560101-61560123 CAGGGGATGGAGCCCTCTGGAGG - Intergenic
1054187805 9:61966957-61966979 CAGGGGATGGAGCCCTCTGGAGG + Intergenic
1054465565 9:65491205-65491227 CAGGGGATGGAGCCCTCTGGAGG - Intergenic
1054650711 9:67621624-67621646 CAGGGGATGGAGCCCTCTGGAGG - Intergenic
1059282803 9:113149280-113149302 CAGGGAAGGAGTGCCTCTGGTGG + Intergenic
1203379462 Un_KI270435v1:17865-17887 GAGGGCATTAAGGCCTCTGGTGG + Intergenic
1190356947 X:49614605-49614627 CAGGGAATGAAGGCCTCAGGAGG + Intergenic