ID: 972417882

View in Genome Browser
Species Human (GRCh38)
Location 4:38860678-38860700
Sequence GAGCAAAGGAGATCAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972417874_972417882 24 Left 972417874 4:38860631-38860653 CCTACAAATCAATTTTAAAATGA No data
Right 972417882 4:38860678-38860700 GAGCAAAGGAGATCAACAGATGG No data
972417879_972417882 -7 Left 972417879 4:38860662-38860684 CCCAATGCGGGGAAATGAGCAAA No data
Right 972417882 4:38860678-38860700 GAGCAAAGGAGATCAACAGATGG No data
972417880_972417882 -8 Left 972417880 4:38860663-38860685 CCAATGCGGGGAAATGAGCAAAG No data
Right 972417882 4:38860678-38860700 GAGCAAAGGAGATCAACAGATGG No data
972417878_972417882 -6 Left 972417878 4:38860661-38860683 CCCCAATGCGGGGAAATGAGCAA No data
Right 972417882 4:38860678-38860700 GAGCAAAGGAGATCAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972417882 Original CRISPR GAGCAAAGGAGATCAACAGA TGG Intergenic
No off target data available for this crispr