ID: 972420022

View in Genome Browser
Species Human (GRCh38)
Location 4:38878291-38878313
Sequence GCCTCAGGATGCCAACGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972420015_972420022 -1 Left 972420015 4:38878269-38878291 CCGCCATTGGGCCCCCTGTGCAG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 972420022 4:38878291-38878313 GCCTCAGGATGCCAACGCCCTGG 0: 1
1: 0
2: 3
3: 13
4: 277
972420016_972420022 -4 Left 972420016 4:38878272-38878294 CCATTGGGCCCCCTGTGCAGCCT 0: 1
1: 0
2: 4
3: 23
4: 238
Right 972420022 4:38878291-38878313 GCCTCAGGATGCCAACGCCCTGG 0: 1
1: 0
2: 3
3: 13
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972420022 Original CRISPR GCCTCAGGATGCCAACGCCC TGG Exonic
900346865 1:2214336-2214358 GCCCCAGGTTGCAAAGGCCCGGG - Intergenic
900610636 1:3543168-3543190 GCCTCAGGGTGCCCCGGCCCTGG - Intronic
905969675 1:42131984-42132006 GCCTCAGGGTTACAAGGCCCTGG - Intergenic
906135624 1:43498685-43498707 GCCTCAGCATCCCAAAGTCCTGG + Intergenic
906429865 1:45747576-45747598 GCCTCAGCATCCCAACGTGCTGG - Intronic
907140349 1:52180724-52180746 GCCTCAGGCTCCCAAAGCACTGG - Intronic
911411168 1:97509287-97509309 GCCTCACAATGCCAAAGCCAGGG - Intronic
911647073 1:100348943-100348965 GCCTCAGGATCCCAAAGTGCTGG - Intergenic
914900255 1:151707712-151707734 CCCTCCCGATGCCAAGGCCCCGG - Intronic
915388609 1:155519906-155519928 GCCTCAGCATGCCAAAGTGCTGG + Intronic
917502717 1:175599881-175599903 GCCTCAGCATCCCCACGCCGAGG - Intronic
918045279 1:180937468-180937490 GCCTGAGCCTGCCAACCCCCAGG - Intronic
919577792 1:199333410-199333432 GCCTCAGGCTCCCAAAGCGCTGG - Intergenic
922368511 1:224887741-224887763 GCCTCAGAATGCCCACAGCCTGG + Intergenic
922845403 1:228680352-228680374 GCCTCAGAATGCCCACGGCCCGG - Intergenic
923610557 1:235488802-235488824 GCCTCAGCATCCCAAAGCACTGG - Intronic
924090254 1:240493777-240493799 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
1063785676 10:9380352-9380374 TCCTCGGGATGGCAACCCCCAGG + Intergenic
1064044558 10:12000528-12000550 GCCTCAGCCTCCCAAGGCCCTGG - Intronic
1064678904 10:17789629-17789651 GCCTCAGCCTCCCAACGCACTGG - Intronic
1065915903 10:30354813-30354835 GCCCCAGGATGTCAAGGGCCAGG - Intronic
1065937530 10:30534079-30534101 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1065945533 10:30602566-30602588 GCCTCAGGCTCCCAAAGTCCTGG - Intergenic
1066105596 10:32154294-32154316 GCCTCAGGCTCCCAAAGCACTGG + Intergenic
1066325949 10:34358576-34358598 GCCTCAGTCTGCCAAAGTCCTGG - Intronic
1070222088 10:74458386-74458408 GCCTCAGGTTGCCAACGTGTTGG + Intronic
1070689469 10:78514012-78514034 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1071131668 10:82400822-82400844 GCCTCAGGCTGCCAAAGTACTGG + Intronic
1071933635 10:90501534-90501556 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
1072690754 10:97570975-97570997 GCCTCAGGCTTCCCAAGCCCTGG - Exonic
1073154941 10:101338941-101338963 GCCTCAGCCTCCCATCGCCCAGG + Intergenic
1074381163 10:112981904-112981926 GCCCCAGCATGCCAGCCCCCAGG + Intronic
1075958753 10:126548291-126548313 GCCTCAGCATTCCAAAGTCCTGG - Intronic
1077327112 11:1968675-1968697 CCCTCAGGATGCCCACGCCCTGG - Intronic
1077418216 11:2435905-2435927 GTCTCAGGATGCCCACACTCTGG + Intergenic
1077943350 11:6867997-6868019 GCCTCAGGCTCCCAAAGTCCTGG + Intergenic
1078162872 11:8857000-8857022 GCCTCAGTCTGCCAAAGCACTGG + Intronic
1078612097 11:12829829-12829851 GCCCCTTGATGCCAACACCCAGG - Intronic
1079386903 11:19988659-19988681 GCCTCTGAGTGCCAAGGCCCTGG - Intronic
1079414093 11:20216677-20216699 GCCTGATGGTGCCCACGCCCAGG - Intergenic
1081950594 11:47039378-47039400 GCCTCAGCCTGCCAACTGCCTGG - Intronic
1082188413 11:49211813-49211835 GTCTCAGGCTCCCAAAGCCCTGG + Intergenic
1084653798 11:70503717-70503739 GACTCAGGGTGCCATCCCCCTGG + Intronic
1086566514 11:88232576-88232598 CCCTCAGTATGCCCAAGCCCTGG - Intergenic
1088487637 11:110356012-110356034 GCCTCAGCCTGCCAAAGTCCTGG + Intergenic
1089787197 11:120916213-120916235 GCCCCAAGAAGCTAACGCCCAGG + Intronic
1089960641 11:122614476-122614498 GCCTCAGGGTGACAAAGTCCAGG - Intergenic
1090347255 11:126081517-126081539 GCCTCAGCATCCCAAGGCACTGG + Intergenic
1202810094 11_KI270721v1_random:23855-23877 CCCTCAGGATGCCCACGCCCTGG - Intergenic
1091858025 12:3754543-3754565 GACTCTGGAGGCCAAAGCCCTGG + Intronic
1092481685 12:8864913-8864935 GCCTCAGGCTGCCAAAGTGCTGG - Intronic
1092801782 12:12175438-12175460 GCCTCAGCTTCCCAAAGCCCTGG - Intronic
1093587136 12:20852223-20852245 GCCTCAGACTTCCAAAGCCCTGG - Intronic
1094129578 12:27060847-27060869 GCCTCTGGATGCTAACTCTCAGG - Intronic
1094436558 12:30426628-30426650 GCCTCAGCCTGCCAAAGTCCTGG - Intergenic
1096286260 12:50303217-50303239 GCCTCAGGCTCCCAACGTGCTGG - Intergenic
1096758215 12:53817546-53817568 GCCTCTGGAAACCAAAGCCCAGG - Intergenic
1101012589 12:100466614-100466636 GCCTCAGGCTCCCAAAGCACTGG - Intergenic
1101451908 12:104787474-104787496 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
1101855105 12:108435673-108435695 GCCTCAGCATCCCAAAGTCCTGG + Intergenic
1102305737 12:111803346-111803368 GCCTCAGGCTCCCAAAGCACTGG - Intronic
1102531947 12:113553184-113553206 ACTTCAGGATGCAGACGCCCAGG - Intergenic
1103602887 12:122065272-122065294 GCCTCGGGATGGCAAGGACCAGG + Intergenic
1104390780 12:128389091-128389113 AGCTCAGGCTGCCAACCCCCTGG - Intronic
1104840212 12:131820578-131820600 GCCTCAGCCTTCCAACGCACTGG - Intergenic
1107162624 13:37249404-37249426 GCCTCAGCATGCCAAAGTGCTGG + Intergenic
1107801015 13:44108035-44108057 GCCTTAACATGCCAATGCCCTGG + Intergenic
1108938837 13:55922859-55922881 GCCTCAGCCTGCCAAAGCACTGG + Intergenic
1115824450 14:37251315-37251337 GCCTCAGACTCCCAAAGCCCTGG + Intronic
1116903790 14:50386180-50386202 ACCTCAGCCTGCCAAAGCCCTGG - Intronic
1116929761 14:50678434-50678456 GTCTCAGGAGGCTAAAGCCCAGG - Intergenic
1118887415 14:69878852-69878874 GACTCAGGATGTCACCTCCCAGG + Intronic
1118906655 14:70028306-70028328 GTCTGAGGATGCCAACTGCCTGG + Intronic
1121567891 14:94924251-94924273 GCCTCTGCAGGCCAAAGCCCAGG - Intergenic
1122744951 14:103891966-103891988 GCCTCTGGACCCAAACGCCCCGG - Intergenic
1125595918 15:40886061-40886083 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1125645416 15:41268395-41268417 GCCTCAGCCTGCCAAAGCCCTGG - Intronic
1126026548 15:44451357-44451379 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
1126297668 15:47159199-47159221 GCCTGAGCTTGCCAACTCCCTGG + Intergenic
1126795992 15:52260980-52261002 GCCTCAGGCTGTCAACGCCAGGG - Exonic
1127032593 15:54880412-54880434 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1127887173 15:63212080-63212102 GCCTCAGCATCCCAAAGCGCTGG + Intronic
1128274037 15:66337569-66337591 GCCTCAGGCTCCCAAAGTCCTGG + Intronic
1129023577 15:72547174-72547196 GCCTCAGCATGCCAAAGTGCTGG + Intronic
1129369179 15:75077652-75077674 GCCTCAGGAAGCACAGGCCCTGG - Intronic
1130101629 15:80898963-80898985 GCCTCAGCATCCCAAAGTCCTGG - Intronic
1131109480 15:89756168-89756190 GCCCCAGAATGCCTATGCCCAGG + Intergenic
1133123043 16:3623682-3623704 GCCTCAGCATCCCAAAGTCCTGG - Intronic
1133937151 16:10278406-10278428 GACTCAGGATCCCTAAGCCCAGG - Intergenic
1134098470 16:11435361-11435383 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
1135534556 16:23283159-23283181 GCCTCAGCCTCCCAACGTCCTGG - Intronic
1136072175 16:27794265-27794287 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
1136471213 16:30481818-30481840 GCCTCAGCTTCCCAAAGCCCTGG - Intronic
1136482431 16:30550896-30550918 GCCTCAGCCTGCCAACGTGCTGG + Intronic
1137498558 16:48992716-48992738 GCCTCAGGCTCCCAAAGCACTGG - Intergenic
1141548598 16:84789044-84789066 GCCTCAGGATGTCAACAACTGGG - Intergenic
1141911988 16:87066586-87066608 GGCTCAAGATGCCCACGGCCCGG - Intergenic
1142068446 16:88075993-88076015 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
1143658826 17:8312531-8312553 GGCTCAGGATGCAGATGCCCCGG + Exonic
1144226159 17:13149052-13149074 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
1144667736 17:17113085-17113107 GCCTCAAGTTGCCACCCCCCAGG - Intronic
1144736461 17:17558255-17558277 GCCTCAGCCTCCCAAAGCCCTGG - Intronic
1145856380 17:28162381-28162403 GCCTCAGCATCCCAAAGCGCTGG - Intronic
1147848220 17:43420431-43420453 GCCTCAGCCTCCCAACGTCCTGG + Intergenic
1148062490 17:44846431-44846453 GCACCAGCATGCCAACGACCTGG + Intronic
1148258087 17:46154529-46154551 GCCTCAGCATCCCAAAGCACTGG + Intronic
1148496655 17:48056978-48057000 GCCCCAGGCAGCCAAGGCCCAGG + Intronic
1151554825 17:74841506-74841528 GCCCCAGGATTCCAGAGCCCAGG + Intergenic
1152796292 17:82309228-82309250 GCCTCAGGATGCCAGCTCTCAGG + Intergenic
1152931468 17:83112198-83112220 CCCGCAGGAGGTCAACGCCCGGG - Intergenic
1156478859 18:37423668-37423690 GCCTCAGGAGACCAAGGCCATGG - Intronic
1158511239 18:58092423-58092445 GGCACAGTATGCCAAGGCCCAGG + Intronic
1158970660 18:62663314-62663336 GCCTCAGCCTCCCAACGTCCTGG + Intergenic
1159240216 18:65732664-65732686 GCCTCAGGCTGCCAAAGTGCTGG - Intergenic
1159678432 18:71316283-71316305 GCCTCAGGCTCCCAAAGCACCGG - Intergenic
1161352931 19:3803837-3803859 GCCTGAGGATGCCCACACCTTGG + Intergenic
1161430655 19:4230329-4230351 GCCTCACGATCCTCACGCCCTGG - Intronic
1161447854 19:4328198-4328220 GCCTCAGGATCCCACGACCCCGG + Intronic
1163642951 19:18472210-18472232 GCCTCAGCATCCCAAAGTCCTGG + Intronic
1165361985 19:35342416-35342438 GCCTCAGCTTCCCAAAGCCCTGG + Intronic
1165393992 19:35554000-35554022 GCACCAGGATGCCAACACCCAGG - Intronic
1165493334 19:36138254-36138276 GCCTCAGCATCCCAAAGTCCTGG + Intergenic
1165568858 19:36757934-36757956 GCCTCAGCCTCCCAAAGCCCCGG + Intronic
1166154981 19:40904203-40904225 GCCTCAGCCTCCCAACGCCCTGG - Intergenic
1167090765 19:47342103-47342125 GCCTCAGCCTCCCAAAGCCCTGG - Exonic
1167339730 19:48907993-48908015 TCCTCAGGGTGTCACCGCCCCGG + Intronic
1168388950 19:55990336-55990358 GCCTCAGGATCCCAAAGTGCTGG + Intergenic
925013885 2:507126-507148 CCCTCAGCATGCCATCTCCCTGG - Intergenic
925256575 2:2494469-2494491 GCCTCAGCATGCCAAAGTGCTGG + Intergenic
925404897 2:3599685-3599707 CCCTCAGGATGCCAAGTCCCGGG + Intronic
927200233 2:20573597-20573619 GCCTCTGGAAGCAAAGGCCCGGG - Intronic
928139841 2:28718850-28718872 GCCTCAGCATGCCAAAGTGCTGG - Intergenic
929503317 2:42508580-42508602 GCCTCAGGCTCCCAAAGTCCTGG + Intronic
934743749 2:96744716-96744738 GCCTCAGCATCCCAAAGCGCTGG - Intergenic
934970890 2:98763157-98763179 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
935717197 2:105949782-105949804 GCCTCAGGCTCCCAAAGCGCTGG - Intergenic
936390169 2:112065394-112065416 GCCTCAGGTTCCCAAAGCGCAGG - Intronic
937140646 2:119596966-119596988 GCCTCATGATGCCAAATCACTGG - Intronic
937924444 2:127157193-127157215 GCCTCAGCCTCCCAACGTCCTGG - Intergenic
938340488 2:130532871-130532893 GCCCCTGGATTCCAACCCCCAGG + Intergenic
938349342 2:130587848-130587870 GCCCCTGGATTCCAACCCCCAGG - Intergenic
940075409 2:149735925-149735947 TCCTCAGGAAACCAACGCTCAGG - Intergenic
940414764 2:153406655-153406677 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
940452857 2:153861826-153861848 GCCTCAGCATCCCAAAGCACTGG + Intergenic
941266126 2:163365571-163365593 GCCTCAGCCTCCCAACGTCCTGG + Intergenic
942557363 2:177185702-177185724 GCCTCAGGTTCCCAAAGCGCTGG + Intergenic
942603627 2:177667161-177667183 GCCTCAGCATCCCAAAGCGCTGG + Intronic
945972923 2:216247649-216247671 GCCTCAGGCTCCCAAAGCGCTGG + Intergenic
946042997 2:216798441-216798463 GCCTCAGGAGGCCAACCCCTAGG - Intergenic
946907811 2:224432994-224433016 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
947615309 2:231552605-231552627 GCCTCAGACTCCCAAAGCCCTGG + Intergenic
948190010 2:236051384-236051406 GCCTGAGGATGCCAGGGCTCGGG + Intronic
1169506061 20:6213073-6213095 GCCTCAGGATGCGCACCCGCGGG - Intergenic
1169973050 20:11291606-11291628 GCCTCAGTCTCCCAAAGCCCTGG - Intergenic
1170588319 20:17752241-17752263 GCCTCAGCATTCCAAAGCTCTGG - Intergenic
1170607220 20:17883212-17883234 GCCTCAGTCTGCCAAAGCGCTGG - Intergenic
1172294707 20:33800618-33800640 GCCTCAGCATCCCAAAGTCCTGG - Intergenic
1172778179 20:37420176-37420198 TCCTCCAGATGCCCACGCCCAGG + Intergenic
1173336201 20:42114088-42114110 GCCTAAGGATGCAAAAGCACTGG - Intronic
1174212711 20:48892551-48892573 GCCTCAGCCTCCCAAAGCCCCGG + Intergenic
1175940305 20:62534734-62534756 GCCTCAGGAGGCCAATGAGCCGG - Intergenic
1177379859 21:20326216-20326238 GCCTCAGGCTGCCAAAGTGCTGG - Intergenic
1177844278 21:26270582-26270604 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1178846731 21:36180317-36180339 GCCTCAGCCTCCCAAAGCCCTGG - Intronic
1179924767 21:44528412-44528434 GGCCCTGCATGCCAACGCCCCGG + Intronic
1181639553 22:24189484-24189506 TCCTCAGGAGACCAGCGCCCAGG + Intergenic
1181734787 22:24873210-24873232 GCCTCAGGCTCCCAAAGTCCTGG + Intronic
1182328905 22:29536395-29536417 GCCTCTGGATGAAAACACCCAGG + Intronic
1182756788 22:32686842-32686864 GCCTCAGGATCCCAAAGTGCTGG + Intronic
1183562836 22:38589995-38590017 GCCTCAGCCTCCCAAAGCCCTGG - Intronic
1184360066 22:44011221-44011243 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
1184956248 22:47888553-47888575 GCCTCACGATGCCAGGCCCCCGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950164014 3:10780064-10780086 GCCTCAGGCTCCCCACACCCAGG - Intergenic
950187736 3:10955806-10955828 GCCTTAGGATTCCCAGGCCCAGG - Intergenic
950490819 3:13303909-13303931 GCCTCAGGATGCCACTTCCAGGG + Intergenic
951038570 3:17962660-17962682 GCTGCAGGATGCCAGCCCCCTGG - Intronic
953018739 3:39100624-39100646 GCCTCAGGATCCCTGGGCCCAGG + Intronic
953807801 3:46086394-46086416 GCCTCAGCCTGGCCACGCCCAGG - Intergenic
953992527 3:47495338-47495360 GCCTCATGTGGCCAAGGCCCTGG + Intergenic
954037304 3:47858260-47858282 GCCTCAGGATCCCAAAGTGCTGG + Intronic
954322211 3:49839994-49840016 GGCTCAGGAGGCCAAGCCCCAGG + Intronic
954771415 3:52973100-52973122 GCCTCAGGCTTCCAAAGCACTGG - Intronic
955270546 3:57493981-57494003 GCCTCAGCATCCCAAAGCTCTGG - Intronic
956142541 3:66160237-66160259 GCCTCAGCATGCCAAAGTGCTGG + Intronic
957223413 3:77412965-77412987 GCCTCAGGCTCCCAAAGCGCTGG - Intronic
959748235 3:109802887-109802909 GCATAGGGATGCCAACTCCCTGG + Intergenic
960638436 3:119806533-119806555 GCCTCAGCCTCCCAAAGCCCCGG + Intronic
961624805 3:128254567-128254589 GCCTCAGGCTGCCATTGCCTGGG + Intronic
964176034 3:153826688-153826710 GCCTCAGAATGCCCACAGCCTGG - Intergenic
964217489 3:154302826-154302848 GCCTCAGCATCCCAAAGTCCTGG - Intronic
964452330 3:156824261-156824283 GCCTCAGCCTGCCAAAGCTCTGG + Intergenic
965023697 3:163269746-163269768 GCCTCAGGCTGCCAAAGCGCTGG - Intergenic
965764505 3:172115690-172115712 ACCTTAGGATGCCACCGCCGAGG - Intronic
967063952 3:185897643-185897665 GCCTCAGCATCCCAAAGTCCTGG - Intergenic
967087027 3:186104989-186105011 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
969681797 4:8647168-8647190 GTCTCAGGAGGCCACAGCCCAGG - Intergenic
971175433 4:24277923-24277945 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
972420022 4:38878291-38878313 GCCTCAGGATGCCAACGCCCTGG + Exonic
973051725 4:45607219-45607241 GCCTCAGCCTGCCTGCGCCCAGG + Intergenic
973941127 4:55911514-55911536 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
975334698 4:73162297-73162319 GCCTCAGCATGCCAAAGTACTGG + Intronic
976449532 4:85172015-85172037 GCCTCAGCATCCCAAAGTCCTGG - Intergenic
981025812 4:140076114-140076136 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
982965233 4:161898876-161898898 GCCTCAGCATCCCAAAGTCCTGG + Intronic
983803896 4:171969082-171969104 GCCTCAGCATCCCAAAGTCCTGG + Intronic
984620910 4:181950789-181950811 GCCTCAGACTGCCAAAGCGCTGG - Intergenic
984767789 4:183412839-183412861 ACCTCAGGAATCCAAGGCCCCGG + Intergenic
988588807 5:32531040-32531062 GCCTCAGGCTCCCAAAGTCCTGG + Intergenic
989980294 5:50635454-50635476 GCCTCAGGATCCCAAAGTGCTGG - Intergenic
992798528 5:80274869-80274891 GCCTCAGCATCCCAAAGTCCTGG + Intergenic
996079429 5:119240017-119240039 GCCTCAGCCTGCCAAGGCACTGG - Intronic
996229679 5:121046430-121046452 GCCTCAGCTTCCCAACGCACTGG + Intergenic
997885932 5:137630036-137630058 GCCTCAGGCAGCCAAAGGCCAGG + Intronic
1000876368 5:166643382-166643404 GCCTCAGGCTCCCAACGTGCTGG + Intergenic
1001358180 5:171053067-171053089 GCCTCAGCATCCCAAAGTCCTGG + Intronic
1001502923 5:172253142-172253164 GCCTCAGGATCCCAAAGTGCTGG + Intronic
1002612041 5:180426507-180426529 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1005251671 6:23953017-23953039 TCCTCAGAATGCCCAGGCCCTGG - Intergenic
1006049490 6:31330617-31330639 GTCTCAGGATGCAAATGCCTGGG - Intronic
1008189728 6:48439643-48439665 GCCTCAGGGTGCCCTCCCCCTGG + Intergenic
1011173493 6:84533805-84533827 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
1012887898 6:104865736-104865758 GCCTCAGGCTCCCAACGTGCTGG - Intergenic
1013201729 6:107904160-107904182 GCCTCAGCCTCCCAAAGCCCTGG - Intronic
1013228159 6:108136021-108136043 GCCTCAGCCTTCCAAAGCCCTGG + Intronic
1013633717 6:112009211-112009233 GGGACAGGATGCCAACTCCCAGG + Intergenic
1014724976 6:124962640-124962662 GCCTCAGGGGGACAGCGCCCGGG + Exonic
1016812389 6:148273755-148273777 GCCTCAACTTGCCAAAGCCCAGG - Intronic
1017922826 6:158886446-158886468 GCCTCAGAATGCCCACAGCCTGG - Intronic
1019013788 6:168864772-168864794 TCCTCAGGATGCCAGCCCACTGG + Intergenic
1019641762 7:2107100-2107122 GCCTGAGGATGGCAGCGCACCGG + Intronic
1020009281 7:4799628-4799650 ACCTCAGGTAGCCAAGGCCCAGG + Exonic
1020028542 7:4916819-4916841 GCCTCAGCCTCCCAACGCTCTGG - Intronic
1020113468 7:5461315-5461337 GCCTCAGCCTGCCAAAGCGCTGG - Intronic
1021692045 7:23240081-23240103 GCCTCAGCCTCCCAAAGCCCTGG - Intronic
1021695810 7:23275246-23275268 GCCTCAGCATCCCAAAGCGCTGG + Intergenic
1021811586 7:24407020-24407042 GCCACAGGAGGCCACTGCCCAGG + Intergenic
1021861577 7:24910979-24911001 GTCTCAGGATGCCCTTGCCCTGG - Intronic
1022296881 7:29063819-29063841 GCCTCAGGCTCCCAAAGCACTGG + Intronic
1023434160 7:40125064-40125086 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
1023592173 7:41792047-41792069 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1023772580 7:43571807-43571829 GCCTCAGGATCCCAAAGTGCAGG - Intergenic
1026248842 7:68648847-68648869 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
1026535556 7:71235928-71235950 GCCTCAGCATGCCAAAGTGCTGG - Intronic
1028031122 7:85914354-85914376 GCCTCAGCATCCCAAAGTCCTGG - Intergenic
1029240607 7:99159112-99159134 GCCTCAGGCTCCCAAAGCACTGG + Intergenic
1029252832 7:99249295-99249317 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
1029566230 7:101340065-101340087 GCCTCAGCATCCCAAAGTCCTGG - Intergenic
1030521974 7:110608573-110608595 GCCTCAGCCTCCCAAAGCCCTGG - Intergenic
1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG + Intergenic
1036720659 8:11172119-11172141 GCCTCAGGCTCCCAACGTGCTGG - Intronic
1037139557 8:15503751-15503773 GCCTCAGGATCCCAAAGTGCCGG - Intronic
1037562428 8:20087032-20087054 GCCTCAGGATACCCACGTCCTGG - Intergenic
1039492403 8:37957858-37957880 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1039701473 8:39966274-39966296 GCCTCAGCCTCCCAAAGCCCTGG + Intronic
1040812771 8:51475119-51475141 GCGTCTGGATTCCAACGCCCTGG - Exonic
1040859359 8:51983443-51983465 ACCTCAGCATCCCAAAGCCCTGG + Intergenic
1041733871 8:61089667-61089689 GCCTCAGCCTCCCAAAGCCCTGG - Intronic
1041895109 8:62915376-62915398 GTCTCAGGCTGCCATCTCCCTGG - Intronic
1042189159 8:66167997-66168019 GCCTCAGCTTGCCAAAGCACTGG + Intronic
1046405518 8:113767789-113767811 GCCTCAGGCTTCCAAAGCACTGG + Intergenic
1049611090 8:143555654-143555676 GCCCCTGGAAGCCAGCGCCCTGG - Intronic
1049654863 8:143792975-143792997 GCCTGAGGATGCCCCTGCCCAGG - Exonic
1049773481 8:144394285-144394307 CCCCCAGGATGCCAAGCCCCTGG - Exonic
1050311023 9:4353438-4353460 GCCTCAGGATTCCAAAGTTCAGG + Intergenic
1052990727 9:34518110-34518132 GGCTCAGGATTCCAAGGCCCGGG - Intronic
1054943389 9:70768669-70768691 GCCTCAGGCTCCCAAAGCACTGG - Intronic
1055435510 9:76288307-76288329 GCCTCAGGCTACCAAAGCCCTGG - Intronic
1056742393 9:89269110-89269132 GCCTCAGCATCCAAAAGCCCTGG + Intergenic
1056765839 9:89443888-89443910 CCCTGAGGATGCCCATGCCCAGG - Intronic
1057322579 9:94028544-94028566 GCCAAAGGATGCAAACTCCCTGG + Intergenic
1058950260 9:109896559-109896581 GCCTCAGGCTGCCAACAAACTGG - Intronic
1061132452 9:128715498-128715520 CCCTCTGGATGCCACAGCCCAGG - Intronic
1061712810 9:132499313-132499335 GCCTCAGGGTGCTTACTCCCAGG + Intronic
1062346248 9:136116636-136116658 GCAGCAGGACGCGAACGCCCAGG + Exonic
1203695899 Un_GL000214v1:96674-96696 GCCTCTGGATGGCAAAGCTCCGG + Intergenic
1203640374 Un_KI270751v1:7389-7411 GCCTCTGGATGGCAAAGCTCCGG - Intergenic
1185449956 X:276587-276609 GCCTGTGGCTGCCAACGTCCAGG - Intronic
1186547458 X:10465344-10465366 TCCCCAGGATTCCAACTCCCTGG + Intronic
1188182888 X:27077128-27077150 GCCTCAGGAAACCAACCCTCAGG + Intergenic
1188891101 X:35611749-35611771 GCCTCAGAATGCCCACAGCCCGG + Intergenic
1189235652 X:39484928-39484950 GGCCCAGGAGGCCAACTCCCTGG - Intergenic
1189688129 X:43587094-43587116 GTCTCAGGAAGATAACGCCCAGG - Intergenic
1190038832 X:47052380-47052402 GCCTCAGCATGCCAAAGTGCTGG - Intronic
1190175654 X:48146906-48146928 GCCTCAGGCTCCCAAAGTCCTGG + Intergenic
1190288128 X:48973994-48974016 CCCTCAGGATCCCCACTCCCTGG + Exonic
1192392512 X:70745483-70745505 GCCTCAGGATCCCAAAGTGCTGG - Intronic
1192784425 X:74322960-74322982 TCCTCAGGATGCTCAGGCCCAGG + Intergenic
1192804207 X:74495348-74495370 TCCTCAGGATGCTCAGGCCCAGG - Intronic
1195571495 X:106402579-106402601 CCCTCAGTATGCCCACTCCCTGG + Intergenic
1196436390 X:115678518-115678540 ACCTCAGCCTGCCAAAGCCCTGG - Intergenic
1198547559 X:137708896-137708918 GCCTCAGCCTCCCAAAGCCCTGG + Intergenic
1200800631 Y:7384083-7384105 GCCTCAGGCTCCCAACGTTCTGG - Intergenic
1201694967 Y:16814742-16814764 GCCTCAGCATCCCAACGTGCCGG - Intergenic