ID: 972422015

View in Genome Browser
Species Human (GRCh38)
Location 4:38896545-38896567
Sequence AGTTGCCCACACATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972422015 Original CRISPR AGTTGCCCACACATGGAGCC AGG Intronic
900228965 1:1546440-1546462 AGTTCCCCAGAGATGGACCCGGG - Intronic
902199446 1:14822809-14822831 GGTGGCCCACACATGAAGACAGG + Intronic
902246826 1:15126348-15126370 ACTTGCCCACAAAAGCAGCCTGG - Intergenic
902638716 1:17752134-17752156 TGCTGCCCACATATGGAGACAGG + Intergenic
902809444 1:18879910-18879932 GGTTGGTCACACTTGGAGCCTGG - Intronic
912569685 1:110612420-110612442 AGTTGCCCAAACCAGAAGCCTGG + Intronic
916605395 1:166337574-166337596 AAAAGCCCTCACATGGAGCCAGG - Intergenic
1062892594 10:1075476-1075498 AGTTGCTAACACATGGACACAGG - Intronic
1065088090 10:22200467-22200489 AGTTCCTCACACGTGGAACCAGG + Intergenic
1065320097 10:24501440-24501462 AGGTGCCCACAGGTGGAGGCTGG - Exonic
1068589645 10:58840443-58840465 ACATGCCCACCCATGAAGCCTGG + Intergenic
1071947867 10:90668360-90668382 AGTTGCCAACAAATGGTTCCAGG - Intergenic
1074592482 10:114826167-114826189 TGTTTCCCTCACTTGGAGCCAGG - Intronic
1075016258 10:118911978-118912000 AGTCACCCAAGCATGGAGCCTGG + Intergenic
1076373409 10:129968646-129968668 AGTCGCGCACAAAGGGAGCCCGG + Intergenic
1078126053 11:8564632-8564654 AGTTAACCACAGATGGACCCTGG + Intronic
1079454734 11:20626569-20626591 AGTTGTCCCCAAATGCAGCCAGG - Intronic
1082090188 11:48082681-48082703 AGTGGCACACACCTGAAGCCAGG - Intronic
1083642916 11:64155094-64155116 AGGTGCCCACACACCGTGCCAGG - Intronic
1089222576 11:116886835-116886857 ATTTGCCAACACATGAAGCCAGG + Intronic
1089852995 11:121516414-121516436 AGATGGCCACACAGGGAGTCAGG + Intronic
1094376449 12:29794923-29794945 AGTTGCACACCCATGAAGCCAGG + Intergenic
1098587799 12:72175157-72175179 AGTTGCCAACAACTGCAGCCAGG - Intronic
1098747970 12:74264621-74264643 AGTTGCTCACTCAGGGAGCTCGG + Intergenic
1104648909 12:130517027-130517049 AGTTTCCCACACATGGAATTTGG - Intronic
1104742830 12:131191284-131191306 AGTTGGCCACACATCCAGCAAGG + Intergenic
1106295406 13:28409021-28409043 TGTTTCCAACACATGGAGCTAGG + Intronic
1110521169 13:76478541-76478563 AGTTGTTCACACATGGAGAAAGG - Intergenic
1112588574 13:100742681-100742703 AGAGGCCCACACATGTTGCCAGG + Intergenic
1113451005 13:110409701-110409723 ATTTGTCCAGACATGAAGCCCGG - Intronic
1113709142 13:112452619-112452641 AGGGGCGCACACACGGAGCCGGG + Intergenic
1115494830 14:33992831-33992853 AATTGCCCACACAAGAAGCCTGG - Intronic
1117258208 14:54001955-54001977 ATTTGCCCACACATGCATGCAGG - Intergenic
1121013867 14:90536604-90536626 GGTTGCTCACACATGGAGCTGGG - Exonic
1123398536 15:19961291-19961313 AGTTGCCCAGACAGAGACCCAGG - Intergenic
1123947849 15:25247570-25247592 CCATGCCCACACAGGGAGCCTGG - Intergenic
1124808123 15:32906890-32906912 ACTTGCTCTCACATGGAGCATGG - Intronic
1125383898 15:39115689-39115711 ATGTGCCTACACATGGAGCTGGG - Intergenic
1131139228 15:89963630-89963652 AGATGCCCAGATGTGGAGCCTGG - Intergenic
1132847631 16:2007702-2007724 AGTTCCACACACCTGGACCCAGG - Intronic
1132937001 16:2486279-2486301 CGTTCCCCACCCATGGGGCCCGG + Intronic
1132954644 16:2585243-2585265 GGCTGCCAACAAATGGAGCCTGG - Intronic
1133460961 16:5985705-5985727 AGTTGCACACGCATGGTACCTGG + Intergenic
1137499142 16:48997237-48997259 GGTTGCCCAGACCTGAAGCCAGG - Intergenic
1137529468 16:49268868-49268890 AATTGGCCAAGCATGGAGCCAGG - Intergenic
1137822400 16:51458622-51458644 GGTTGTTCACACAAGGAGCCGGG + Intergenic
1138461354 16:57149727-57149749 ATCTGCCCCCACATGAAGCCTGG - Intergenic
1138957511 16:61989335-61989357 GTTTTCCCACACATGGAGACTGG + Intronic
1139031029 16:62880852-62880874 AGTTACTCACACAAGGAGTCTGG + Intergenic
1141851380 16:86648527-86648549 TGTTGCCCACAGAAGGGGCCTGG - Intergenic
1144124506 17:12190006-12190028 AGTTTCCAAAACATGGAGCTGGG + Intergenic
1145247620 17:21279986-21280008 AGTTGCCCGCCTAGGGAGCCAGG + Intergenic
1146376608 17:32298800-32298822 AGATGCCTTCAGATGGAGCCAGG - Intronic
1146571202 17:33954809-33954831 AGTTTCCCTGACATGCAGCCCGG + Intronic
1146688592 17:34857640-34857662 AGTTGCCAACCAATGGGGCCTGG - Intergenic
1146722311 17:35132126-35132148 AGGGGCCCACTCATAGAGCCTGG + Exonic
1152296097 17:79467722-79467744 AGGTGCCCACTCCTGGATCCTGG - Intronic
1158535723 18:58306569-58306591 AGTGGCCCAAACATGAACCCAGG - Intronic
1160332637 18:78009358-78009380 GACTTCCCACACATGGAGCCAGG + Intergenic
1160373420 18:78392395-78392417 AGGTGCCCACAGACGGAGGCGGG + Intergenic
1162698490 19:12495780-12495802 AGCTGCCCACACAGGGCTCCGGG - Intronic
1167309650 19:48729491-48729513 AGGTGTCCACATAGGGAGCCGGG + Exonic
1168698052 19:58416942-58416964 TGTTGCCCACAACTGGAACCAGG - Exonic
928099980 2:28431264-28431286 AGTAGGCCACACATGGGCCCTGG + Intergenic
928369985 2:30733671-30733693 CGTTGCCCCCACCTGTAGCCTGG - Intronic
931209730 2:60181011-60181033 AGTAACCCAAACATTGAGCCTGG - Intergenic
939778639 2:146416924-146416946 AGTTACCTAGACATGGAGCAAGG + Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
942522824 2:176821924-176821946 AGTGGCTAACACATGGAGCTAGG - Intergenic
946396087 2:219444437-219444459 AGGGGCCCAGAGATGGAGCCAGG + Intronic
946417504 2:219547766-219547788 AGTGGACCCCACACGGAGCCTGG - Exonic
948176535 2:235948008-235948030 AGGTGGGCACACAGGGAGCCTGG - Intronic
948407508 2:237733358-237733380 AGATGTCCACACATGAAGACAGG - Intronic
948656657 2:239480444-239480466 AGTTGCCCCCACATGCCGCATGG + Intergenic
1169543192 20:6622995-6623017 ACATACCCACCCATGGAGCCAGG + Intergenic
1170044977 20:12075312-12075334 AGATGCCCACCCATGGATCAGGG + Intergenic
1172274408 20:33671949-33671971 AGTGCCTCACACAAGGAGCCTGG + Intronic
1172601660 20:36188056-36188078 AGTGGCACACACTTGGTGCCAGG - Intronic
1174941221 20:54930737-54930759 TGTTGTCCACACAGGGAGGCTGG - Intergenic
1176745228 21:10646033-10646055 AGTTGCCCAGACAGAGACCCAGG - Intergenic
1181372485 22:22429374-22429396 AGCTGCCCACACATGGTGGGTGG + Intergenic
1183336819 22:37253354-37253376 TGTTGCCCCCACATGGTTCCAGG - Intergenic
1183494326 22:38133814-38133836 AGCTGCACACACAGGGAGCCTGG - Intronic
1184664768 22:45982429-45982451 GGTTGGCCACACAAGGATCCTGG + Intergenic
950499026 3:13352443-13352465 AGTTGCCCACCACTGGGGCCTGG - Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
954286421 3:49622792-49622814 AGTGGCCCACACTGGGAACCTGG - Intronic
959100047 3:102000101-102000123 AGTGGCCCAGAGATGGATCCTGG - Intergenic
959976337 3:112464449-112464471 AGTTGTCCACAAATGCAGCCTGG + Exonic
959996498 3:112686349-112686371 AGGAGCCCACACATGGATTCTGG - Intergenic
960724095 3:120653050-120653072 AGGAGCCCACACAGGGAGGCTGG - Intronic
961814733 3:129543622-129543644 AGCTGCCCACAGCTGCAGCCTGG - Intronic
962169268 3:133083375-133083397 AGTTGCCCATACATGGCACATGG + Intronic
965756528 3:172033307-172033329 AGTTTCCAACACATGAAGCTTGG + Intergenic
968145165 3:196292386-196292408 AGTTATCCACCCAAGGAGCCAGG - Intronic
968205291 3:196794477-196794499 ATTTTCCCACACTTGGCGCCAGG - Intronic
970269145 4:14324652-14324674 GGTTGTCCAAGCATGGAGCCTGG - Intergenic
972422015 4:38896545-38896567 AGTTGCCCACACATGGAGCCAGG + Intronic
975064507 4:70043463-70043485 AGTGGCCCAAACTTGGAGCTAGG - Intergenic
975066005 4:70064285-70064307 AGTTGCCCAAACTTGGAGCTAGG - Intergenic
977918852 4:102622325-102622347 ACTTAGCCACACATGGATCCAGG + Intergenic
981655188 4:147104942-147104964 AGAATCCCACACATGAAGCCAGG - Intergenic
985284252 4:188318895-188318917 AATTTCCAACACATGGAGGCTGG - Intergenic
985621095 5:956584-956606 AGTTGCCCTCAGAGGGTGCCGGG - Intergenic
985645625 5:1083455-1083477 AGTTCCCCATACATGCTGCCAGG + Intronic
987208921 5:15658604-15658626 AGTTGCTCACTCAGGGAGCTCGG - Intronic
989096414 5:37785802-37785824 AGTTGCTCACTCAGGGAGCTCGG - Intergenic
990091279 5:52052835-52052857 AGTTTCCAACACATGAATCCGGG + Intronic
993502603 5:88680030-88680052 TGTAGCCCACGCATGTAGCCAGG + Intergenic
995389014 5:111618631-111618653 AGTTGCCAACAAATGCAGTCTGG + Intergenic
997979086 5:138458054-138458076 AGCTGCCCACTGGTGGAGCCAGG - Intergenic
1001052732 5:168425972-168425994 AGCTGGCCTCACCTGGAGCCAGG - Intronic
1002331883 5:178448761-178448783 AGTTTCCCACACATGAAGTCTGG + Intronic
1003097142 6:3151265-3151287 AGTTGCCTACACAAGGAACAGGG - Intronic
1003352827 6:5334930-5334952 GCTTGCCTACACATGGAGCTGGG - Intronic
1005389112 6:25315460-25315482 AAATGCCCACACATGGCGGCAGG + Intronic
1007522230 6:42459779-42459801 GGTTGCACACCCATGGAGCTCGG - Intergenic
1008290801 6:49713576-49713598 CGTCGCCCACACGTGGCGCCTGG - Intronic
1013009333 6:106105566-106105588 CGCTGCCCTCAGATGGAGCCCGG + Exonic
1013090608 6:106897128-106897150 AGTTCTCCACACCTTGAGCCAGG + Intergenic
1017718343 6:157227816-157227838 GCATGCCCACACATGGAGACCGG + Intergenic
1019538179 7:1539512-1539534 CGCTGCCCACGCCTGGAGCCAGG - Intronic
1021068228 7:16203333-16203355 ACTTGTCCACACCTGGATCCAGG - Intronic
1021582859 7:22175435-22175457 AGTTGCTCTCACAAGGAGCTGGG + Intronic
1025201995 7:56968234-56968256 GAGTGCCCCCACATGGAGCCTGG + Intergenic
1025262768 7:57430799-57430821 AGTTGGTGACACATGGAGCTAGG - Intergenic
1025669952 7:63608694-63608716 GAGTGCCCCCACATGGAGCCTGG - Intergenic
1032089761 7:128905555-128905577 AGTTGTCTAGGCATGGAGCCAGG - Intronic
1032092487 7:128917976-128917998 AGTTGTCTAGGCATGGAGCCAGG + Intergenic
1034901011 7:154907805-154907827 AGTTGGCAAGACCTGGAGCCAGG - Intergenic
1036618332 8:10405323-10405345 AGCTGCCCAAACATGGAGGGAGG - Intronic
1036794056 8:11742823-11742845 AGTTCACCAGAGATGGAGCCTGG - Intronic
1038161653 8:25045310-25045332 AGTTTCCAACACATGGATTCTGG + Intergenic
1039945243 8:42123237-42123259 AATTGCCCACTCAGGGAGCTCGG - Intergenic
1040378140 8:46846285-46846307 GGTAGCCCACACATGAAGTCTGG + Intergenic
1040692290 8:49953517-49953539 AGATGCCCACAGAAGGTGCCTGG + Intronic
1049182942 8:141232197-141232219 AGGCTCCCACACATGGGGCCGGG + Intronic
1049465307 8:142748638-142748660 ACAGGCTCACACATGGAGCCAGG + Intergenic
1051334516 9:16054197-16054219 AGTTGCCCATTCAGGGATCCTGG + Intronic
1185667987 X:1782825-1782847 AGTTTCCAACACATGAAGCTTGG + Intergenic
1187938977 X:24363309-24363331 AGATGGCCAGAAATGGAGCCAGG + Intergenic
1192266269 X:69540069-69540091 AGTTACCCCAAGATGGAGCCAGG - Intergenic
1198119949 X:133582466-133582488 AGTAGCCCACACATTGAGTAGGG - Intronic
1200042887 X:153382454-153382476 AGCTTCCCATAGATGGAGCCAGG - Intergenic