ID: 972422198

View in Genome Browser
Species Human (GRCh38)
Location 4:38898730-38898752
Sequence GGAAAGACTATTCCAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972422196_972422198 -9 Left 972422196 4:38898716-38898738 CCATCATATGGAGAGGAAAGACT 0: 1
1: 0
2: 3
3: 16
4: 174
Right 972422198 4:38898730-38898752 GGAAAGACTATTCCAAAGGAAGG 0: 1
1: 0
2: 2
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972422198 Original CRISPR GGAAAGACTATTCCAAAGGA AGG Intronic
900780240 1:4613277-4613299 GGAAAGACTAATTCAAAGCAAGG - Intergenic
901143163 1:7048656-7048678 GGCAAGACTGTTGCAAGGGAAGG - Intronic
902582227 1:17415253-17415275 GGCAAGAAGATTCCAAGGGAAGG + Intronic
904262237 1:29295446-29295468 GGAAAGACAATTTCATAAGATGG - Intronic
904985641 1:34546220-34546242 GGAAACATTATTCTAAGGGAGGG - Intergenic
905040650 1:34954881-34954903 GGCAACACTAGTACAAAGGATGG + Intergenic
907439689 1:54471585-54471607 GGAAGGAAGATTCCAATGGAGGG + Intergenic
907937425 1:59055245-59055267 GGGAAGCATATTCCAAAGGGAGG + Intergenic
910133214 1:83934010-83934032 GGAAAGATTATTCCACAAGAGGG - Intronic
911497374 1:98648148-98648170 GGCAAAACTATTTCAAAGAAGGG - Intergenic
913541758 1:119827671-119827693 TGAAAGACTTTTACAAAGGTGGG + Intergenic
914760532 1:150594878-150594900 AGAAAGATTATTCAGAAGGAGGG + Intergenic
915138731 1:153752818-153752840 GGCAAGACTGTTCCCAGGGAGGG - Intronic
918121872 1:181547369-181547391 GGATAGAGGATTCCAGAGGAGGG - Intronic
919319859 1:196021944-196021966 GGATAGAGTACTCCAAAAGAGGG - Intergenic
921925206 1:220705523-220705545 GGAAAGGCTTCTCAAAAGGAAGG + Intergenic
922249577 1:223836307-223836329 GGAAACACAATTCCGAAGGAAGG + Intronic
922975234 1:229778671-229778693 GGAAACACAATTCCAAATGGTGG + Intergenic
923061892 1:230483426-230483448 GGACACACTACTCCAAAGTACGG + Intergenic
923144884 1:231190845-231190867 GGAAAGAATAGGACAAAGGAGGG - Intronic
924333597 1:242964947-242964969 GGAAAGAATATTCCACTTGAGGG - Intergenic
1063172740 10:3524099-3524121 GGAAAAAATAGTCCAAAGGCTGG + Intergenic
1065820408 10:29520133-29520155 GGACAGAATATTCCCAAAGATGG + Intronic
1067913798 10:50374810-50374832 GGGAAGAATATTCCAGAAGAAGG - Intronic
1068549579 10:58391336-58391358 GGAAAGACTAAGCCACAGCAGGG - Intronic
1068744968 10:60519400-60519422 GGAAATGTTAATCCAAAGGAAGG + Intronic
1070007242 10:72436175-72436197 GGAACGACACTTCCAGAGGAAGG + Intronic
1071400190 10:85261245-85261267 GGAAAGGGTATTCCTATGGAAGG - Intergenic
1072143027 10:92607178-92607200 GGAAAAACTTTTACAATGGAAGG + Exonic
1073917416 10:108422067-108422089 GGAAAGACTATTTTGAAGAATGG - Intergenic
1074005008 10:109412872-109412894 GGTATGAATAGTCCAAAGGATGG - Intergenic
1078349597 11:10581698-10581720 AGCAAGACTGTTCCACAGGAAGG - Intronic
1079463945 11:20710580-20710602 ACTAAAACTATTCCAAAGGATGG - Intronic
1080160210 11:29165229-29165251 GGAAGGTATATTCCAAAAGATGG + Intergenic
1080216216 11:29844155-29844177 CCCAAGAGTATTCCAAAGGAAGG + Intergenic
1081821920 11:46006809-46006831 AGAAATATTATTCCAAGGGAGGG - Intronic
1083650682 11:64202729-64202751 GGAAAGACAACTCCAGATGATGG - Intronic
1084317304 11:68353046-68353068 GGAAAGACTACTCCCAACCAAGG - Intronic
1084451384 11:69240917-69240939 GGAAAGACTATTGCCCTGGAAGG - Intergenic
1085281583 11:75334489-75334511 GGACAGACTATCCCAATGAAAGG + Intronic
1086059098 11:82681981-82682003 GGAAAGACTATATAAAAGCAAGG + Intergenic
1086907235 11:92432623-92432645 GGAACAAATCTTCCAAAGGAAGG - Intronic
1087585930 11:100121641-100121663 GGAAATACTATTTCAAAATATGG - Intronic
1090452787 11:126821372-126821394 GGTAAGCCCTTTCCAAAGGAAGG - Intronic
1090649140 11:128791282-128791304 GGAAACATTATTCCAAAGTGTGG - Intronic
1092282526 12:7108746-7108768 GGAGAGTCTCGTCCAAAGGAGGG + Intronic
1093569935 12:20655322-20655344 GGAAAGAGGATTCCAAAGAGAGG + Intronic
1094047633 12:26184723-26184745 GGAAAGACTATTACAGAAAATGG + Intronic
1094455967 12:30633100-30633122 GGAAACTATATTCCAAAGCATGG - Intronic
1094616955 12:32044657-32044679 GCAAAGACTATTTCCAAGTAAGG + Intergenic
1096592389 12:52669556-52669578 GGAGAGAGAATTCCAAATGATGG - Intergenic
1096661459 12:53127521-53127543 GGAAATAATATTTCAAAGCATGG - Intergenic
1096778801 12:53980123-53980145 GGACAGACTTCTCCAAAGGTAGG + Intergenic
1097460565 12:59856918-59856940 GGGATGAATCTTCCAAAGGAAGG + Intergenic
1097703551 12:62845126-62845148 CAAAAGACTACTGCAAAGGAGGG + Intronic
1097998207 12:65913489-65913511 GGAAGGACTAACCTAAAGGATGG - Intronic
1098606937 12:72402627-72402649 GCAAAGACTATTTCCAAGTAAGG + Intronic
1098921912 12:76310390-76310412 GCAAAGACAAAGCCAAAGGAAGG - Intergenic
1099103066 12:78466872-78466894 GGAAGGACAATACCAAAGAAAGG - Intergenic
1099157907 12:79202616-79202638 GGAAAGAATATTTGAAAGGCAGG - Intronic
1100912701 12:99383531-99383553 GGGAAGACTATTCCAAACAGTGG - Intronic
1101234282 12:102772687-102772709 GGAAACACTATTCCTGGGGATGG - Intergenic
1102224889 12:111221301-111221323 GGAGAGACGCTGCCAAAGGAAGG + Intronic
1103043639 12:117717123-117717145 GGAAAGATTATCCCCAAGGTGGG - Intronic
1104438874 12:128778889-128778911 GGAAACACTATTCCAAGGCAGGG + Intergenic
1107242273 13:38250770-38250792 GGTAATACAATACCAAAGGAAGG + Intergenic
1108451942 13:50575882-50575904 GAAAAGCCCTTTCCAAAGGAGGG - Intronic
1108705593 13:52982646-52982668 GGAGAGACTATTACAATGCAAGG - Intergenic
1108983916 13:56558247-56558269 GGAAAGATTATTATACAGGAAGG + Intergenic
1109442005 13:62386604-62386626 GGAAACAGTAATACAAAGGAAGG + Intergenic
1109879960 13:68459720-68459742 TGAAAGAATATTCCAAAGAATGG - Intergenic
1111479250 13:88800771-88800793 GGAAAGAGTATTCCAGACAAAGG - Intergenic
1112577958 13:100653703-100653725 TGAAAGCCAATTCCAAATGATGG + Intronic
1113127013 13:106990491-106990513 GGACAGACTTTTCCAGACGAAGG + Intergenic
1113365122 13:109668863-109668885 GGAAAGCATATTCCAAAACAGGG - Intergenic
1115012733 14:28569528-28569550 GGAAATCATAGTCCAAAGGAAGG + Intergenic
1116154093 14:41181448-41181470 GGAAAGACTATTTTGAAGAATGG + Intergenic
1117904905 14:60574652-60574674 GGTAAGAATATTCCTAAGAAGGG + Intergenic
1120171715 14:81252901-81252923 GGAGAGACTAGTTAAAAGGAAGG + Intergenic
1121026935 14:90623018-90623040 GGAAAGAATATTCCAAACAGAGG - Intronic
1121362506 14:93274470-93274492 GGAAACACTTTTCCAATGGAGGG + Intronic
1124452778 15:29811584-29811606 TGAAAGACTATTCCAAATCCAGG - Intronic
1126327699 15:47499264-47499286 AGAAAGACTATTTCTGAGGACGG - Intronic
1126370482 15:47940856-47940878 CGAGAGATTATTCCAAAGAAAGG + Intergenic
1126457568 15:48880619-48880641 GGAAACACTATTCCATCTGAAGG + Intronic
1128491476 15:68150325-68150347 GGAAATACTCTTCCATAGGAAGG + Intronic
1129506246 15:76083854-76083876 GAAAAGAGTATTCCAAAAGTTGG + Intronic
1131913735 15:97238306-97238328 GGAAAGACTTGCCCAAAGCAAGG + Intergenic
1133886291 16:9831200-9831222 GGAAAGACTATTGTAAAGGATGG - Intronic
1134672861 16:16068542-16068564 GGAAAGATTCTTCCAGAGCATGG - Intronic
1138438202 16:57018398-57018420 GGAAAGACCATGGCCAAGGAAGG - Intronic
1140637559 16:76933822-76933844 GGAAATACTATTTCTAAGAATGG - Intergenic
1140782007 16:78305457-78305479 GGAAGAACTCTTCCAAATGATGG + Intronic
1141352816 16:83314521-83314543 GGAAAGACTATTCCCTGAGATGG + Intronic
1144235982 17:13260938-13260960 GGGAAGACTTTTCTGAAGGAAGG - Intergenic
1144324501 17:14165909-14165931 CGAAAGCCTAATCCAAAGCAAGG + Intronic
1148318014 17:46721320-46721342 GGGAAGTCTACTCTAAAGGAAGG - Intronic
1149205196 17:54236060-54236082 GGAAAAACTAGACCAAAGAAAGG + Intergenic
1150066172 17:62111245-62111267 TCAAAGACAATTCAAAAGGATGG + Intergenic
1150908501 17:69363597-69363619 GCAATCTCTATTCCAAAGGAAGG + Intergenic
1152420980 17:80193142-80193164 GGAAATCCTATTCCCAAAGAAGG + Intronic
1153719987 18:7891985-7892007 GGAAAGGCTCCTCCAAAAGAAGG - Intronic
1155744582 18:29337921-29337943 GGAAAGAATATTCCAAGAAAAGG + Intergenic
1158004217 18:52653658-52653680 GGAAAGAACATTCCAAACAAAGG + Intronic
1161578618 19:5068348-5068370 GAAAAGCCCAGTCCAAAGGACGG - Intronic
1162305455 19:9870567-9870589 GGAAAGACAATTAGAGAGGATGG - Intronic
1163789756 19:19299747-19299769 AGAATGACTAGTCCAAGGGATGG + Intronic
1167055532 19:47109476-47109498 AGAAAGAATTTTACAAAGGATGG + Intronic
925053302 2:834181-834203 GGAAAGAGGATGCCAAAGGAGGG + Intergenic
930146677 2:48014137-48014159 TGAAAGAATATTCAAAAGTACGG - Intergenic
931443928 2:62310983-62311005 GCAAAGACTATTCCCAAATAAGG + Intergenic
931808998 2:65835810-65835832 AGAAAAAGTATTGCAAAGGATGG + Intergenic
932692967 2:73929123-73929145 GGCAAGACCACACCAAAGGAGGG - Intronic
935256728 2:101316131-101316153 GAAAAGAAGCTTCCAAAGGAAGG + Intergenic
935456036 2:103268665-103268687 GGAAAGGGTATTCCAAAAGGAGG + Intergenic
936857856 2:116981821-116981843 AGAAAGTCTTTTCCAAATGAAGG + Intergenic
937384957 2:121421211-121421233 TGAAAGACTAATCTAAAAGAAGG + Intronic
937764621 2:125645521-125645543 GGAAAGACTAATCCAGAGTTCGG + Intergenic
937764698 2:125646671-125646693 GGAAAGACTAATCCAGAGTTCGG + Intergenic
937892880 2:126952861-126952883 TGAAAGATTATTGCAAGGGAAGG - Intergenic
940097412 2:149993331-149993353 GGACACACTATTCCAAAATATGG - Intergenic
940526706 2:154825043-154825065 GCACAGACTATTAAAAAGGAAGG - Intronic
941052616 2:160751513-160751535 TGAAAGGCTATTCCAATGTAAGG + Intergenic
942258914 2:174137795-174137817 CGAAGGACTATTCCAGAGCAAGG - Intronic
942583342 2:177446092-177446114 GGAAAGAACAATCCAGAGGAAGG + Intronic
942586618 2:177486402-177486424 GAAAACACTATTACAAAGGAAGG - Intronic
944764094 2:202847053-202847075 GGAAATACTATTCCAAATACAGG + Intronic
946126744 2:217569195-217569217 GGAAAGACTTTTCCACAGTGAGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947758308 2:232585388-232585410 CGAAAGACTGTAACAAAGGAAGG - Intergenic
948570638 2:238915109-238915131 GCAAAGACTTTTCCCAAGTAGGG - Intergenic
1169922994 20:10755379-10755401 CCAAGGACTATTCCAAAGGCAGG - Intergenic
1169923858 20:10762448-10762470 GCAAAGACTCTTTCAAAGCAAGG + Intergenic
1171509877 20:25673445-25673467 GGAAATGCTATTCCTAAGGAAGG + Intergenic
1172222569 20:33283829-33283851 GGAGAGTCTTTTCCACAGGAGGG + Intronic
1173539953 20:43843789-43843811 GGGAAGAGCATTCCAAAGAAGGG + Intergenic
1174079761 20:47962607-47962629 GGAAGGAGTGTTCCAAAAGAGGG + Intergenic
1174137937 20:48393311-48393333 GGAAAGACTGTTTCAGAAGAGGG - Intergenic
1174731879 20:52925837-52925859 GGAAAGAGTTTTCCTAAAGAAGG - Intergenic
1175377900 20:58542115-58542137 GGAAAGACTCTTCAAGAGGCAGG + Intergenic
1177579822 21:23007185-23007207 GGAAGGACTATTCCAAATGTGGG - Intergenic
1179267241 21:39814642-39814664 TGAGAGACTATTCCAAACTATGG - Intergenic
1182204575 22:28610369-28610391 GGAAAGAAGCTTCCAGAGGAAGG + Intronic
1182528782 22:30939384-30939406 GGTAAGACAGTGCCAAAGGATGG + Intronic
1184752945 22:46499594-46499616 GCAAAGACTTGTCCCAAGGACGG + Intronic
949306620 3:2648992-2649014 CGAAAGCCTAATCCAAAGCAAGG + Intronic
950669320 3:14516415-14516437 GGAAAGACTGTTCCCAAGAAGGG + Intronic
951307188 3:21079328-21079350 CCAAAGCCTATTCCAAAGCAAGG - Intergenic
951478767 3:23136685-23136707 GGAAAAAGAATTCCCAAGGAAGG + Intergenic
953066908 3:39481860-39481882 GGAAAAAGTATTTCAAAAGACGG - Intronic
956827148 3:73007992-73008014 GGAAAGACTATTACAGATAAAGG + Intronic
958267783 3:91459980-91460002 TGAAAGCCTAATCCAGAGGAAGG + Intergenic
958890710 3:99779594-99779616 GGAAACACTAGTTCAAAGGCTGG - Intronic
959290637 3:104469179-104469201 GGGATGAATATTCCAGAGGAAGG - Intergenic
959332416 3:105022983-105023005 GGACAGACTATTTCAAAGGAGGG + Intergenic
959394342 3:105818152-105818174 AGAATGATTATTCCAAAGAATGG + Intronic
959897944 3:111626511-111626533 TGAAATACAATGCCAAAGGATGG - Intronic
961922572 3:130443538-130443560 GGAGAGAATATTCAAAATGATGG + Exonic
963736753 3:149025986-149026008 GGCAGGACTAATCCAATGGAAGG + Intronic
963809591 3:149762595-149762617 GGAAAGACTATAGTAAAGGTAGG - Intronic
964279562 3:155049197-155049219 GGAAAGACTATTTCTAAATAAGG - Intronic
964514366 3:157491959-157491981 ATTAGGACTATTCCAAAGGAGGG + Intronic
965183806 3:165437507-165437529 GGAAACACTACTCCAAAATATGG - Intergenic
969928516 4:10608416-10608438 GGAAAGATTATTGGAAAGGATGG - Intronic
970212809 4:13728890-13728912 GGAAAGACGATTGCAGTGGACGG - Intergenic
972064585 4:34924887-34924909 GAAAACAATATTCCAAAGGAAGG + Intergenic
972422198 4:38898730-38898752 GGAAAGACTATTCCAAAGGAAGG + Intronic
973042326 4:45485690-45485712 GTCAAGACTATTCCAATGAATGG + Intergenic
974235014 4:59169670-59169692 GAAAAGCCTAATCCAAAGCAAGG - Intergenic
974259072 4:59501567-59501589 GTAAAGACTACTGCATAGGAAGG + Intergenic
976698363 4:87942239-87942261 GGGAAGAAGATTCCAGAGGAAGG + Intergenic
978486299 4:109257903-109257925 GGAAAGAGAATTTCAAAGGAAGG + Intronic
978832297 4:113102638-113102660 GAAAAGAAAATTCCAAAAGAAGG + Intronic
980097185 4:128503525-128503547 AGAAAGACCATTCCAAATTAAGG - Intergenic
980979185 4:139639443-139639465 GGAAAGACTGTTCCAGTGGTTGG - Intergenic
981500098 4:145440875-145440897 GGAAGGGCCATTCCAGAGGAAGG + Intergenic
981705358 4:147653529-147653551 AGAAAGACTAATCCTAAGGCTGG + Intronic
981896383 4:149805422-149805444 GAAATGACCATCCCAAAGGATGG - Intergenic
982652185 4:158099803-158099825 GGGAAGAGCATTCCAAACGAAGG - Intergenic
983382251 4:167011225-167011247 GCAAGTACTAATCCAAAGGAAGG + Intronic
984685083 4:182658207-182658229 GGAAAGACTATTGCAACAGGAGG - Intronic
985047345 4:185953419-185953441 AGAGAGATTTTTCCAAAGGAAGG - Intronic
985288864 4:188365825-188365847 GGACAGCCTTTGCCAAAGGAAGG - Intergenic
986045549 5:4034047-4034069 GGAAAAACAATTGAAAAGGAGGG + Intergenic
986921539 5:12689449-12689471 TGGAAGACTATTCCAAAAAATGG + Intergenic
988836114 5:35034134-35034156 GTTAAGACTATTCAAAAGAATGG + Intronic
989235658 5:39145844-39145866 GGGAGGATTATTCCAAAGAAGGG - Intronic
990039882 5:51366863-51366885 GGAAAGTCTACTCCTAAAGAAGG - Intergenic
990590586 5:57259038-57259060 GGAAATGCTATTCCAAAAGGAGG + Intronic
991179421 5:63732500-63732522 GGAATGCCTTTTTCAAAGGAAGG + Intergenic
992681662 5:79159608-79159630 GGAAAGACTTGTCCAGAGGCTGG - Intronic
994679124 5:102863426-102863448 GGAAAGAATCCTCAAAAGGAGGG - Intronic
995461553 5:112409196-112409218 GAAAACACTATTCCAAGTGAAGG + Intronic
996146533 5:119983714-119983736 AGAAACACAAATCCAAAGGAAGG - Intergenic
996727786 5:126687622-126687644 CCAAAGACAATTTCAAAGGAGGG - Intergenic
996764499 5:127022371-127022393 GGAAAGAGAATATCAAAGGAAGG + Intronic
1002290775 5:178199271-178199293 GAAAAGACTATTTCCAAGTATGG + Intergenic
1002369368 5:178738812-178738834 GGAAAGAATATTTCAAAAGAAGG - Intergenic
1004075876 6:12343912-12343934 GGAAAGACCTTTGCAATGGAGGG + Intergenic
1005065047 6:21809529-21809551 AGAAAAACAATTTCAAAGGAAGG - Intergenic
1006245841 6:32734814-32734836 GCAAAAACTAATCCAAAAGAAGG - Intergenic
1008987432 6:57561604-57561626 TGAAAGCCTAATCCAGAGGAAGG - Intronic
1009659170 6:66587865-66587887 GGACATACTATCCCAAAGTATGG + Intergenic
1009843372 6:69105508-69105530 GGCAAGACTTTTCAAAAGGAAGG - Intronic
1010493176 6:76499128-76499150 GGAAAAACTAGACCAAAGGAGGG + Intergenic
1010862331 6:80927866-80927888 GGAAAGAGTATTCCAGATAAAGG - Intergenic
1011329467 6:86187689-86187711 GGAAATACTCTGCCAAAGAAAGG - Intergenic
1011553233 6:88548761-88548783 GCAAAGACTATTCCCAAATAAGG + Intergenic
1012084181 6:94802484-94802506 CCAAAGACTAATCCAAAGCAAGG + Intergenic
1013918993 6:115377859-115377881 GGGAAGGATATTCCAAATGAAGG - Intergenic
1014781771 6:125573192-125573214 TGAAAGTCAATTCCAAAAGATGG + Intergenic
1015156552 6:130102697-130102719 GGAAAGAATGTTCCAGGGGATGG - Intronic
1015716928 6:136202445-136202467 GCAAAGACTATTGCCAAGTAAGG + Intergenic
1017079937 6:150658222-150658244 GGAAAGCCTGTTCTAGAGGAAGG + Intronic
1017947951 6:159111071-159111093 GGGAAGACTAAACCTAAGGATGG + Intergenic
1019332981 7:470094-470116 GCAAAGACTATTTCCAAGTAAGG + Intergenic
1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG + Intergenic
1021089196 7:16462373-16462395 GGAAAAACTATTCCCAAAGAAGG + Exonic
1021950398 7:25768717-25768739 GTAAAGACAGTTCCAAAGGGAGG + Intergenic
1022842909 7:34181857-34181879 GAAAAAACAATTTCAAAGGAGGG + Intergenic
1023032763 7:36105192-36105214 GGAAAGTCTCTTTCAGAGGAAGG + Intergenic
1023531388 7:41158917-41158939 TGAAACAGTATTCCTAAGGAAGG + Intergenic
1023868658 7:44251277-44251299 GGCAGGACTATAGCAAAGGAGGG - Intronic
1024581295 7:50803005-50803027 AGAAAGACTCTTCCCAGGGAGGG + Intergenic
1024802948 7:53101975-53101997 AGTAAAACTAATCCAAAGGAAGG + Intergenic
1027487837 7:78784237-78784259 GGAAACAATATCCCAAAGTATGG + Intronic
1027713140 7:81633126-81633148 GGAAAGACTAATAAAAAGAAAGG - Intergenic
1029984131 7:104906067-104906089 GGAAAAACTATACCAATGAATGG - Intronic
1031773936 7:125883233-125883255 GGAAAGACAATTTCCAAGGTTGG - Intergenic
1031793657 7:126142652-126142674 GGACATGCTATTCCAAAAGATGG - Intergenic
1032024685 7:128431568-128431590 GGAAAGACTTTTCCCCATGAGGG + Intergenic
1032524163 7:132567018-132567040 GGAAAGACGGTTCCATAGAAAGG - Intronic
1034309533 7:150074663-150074685 GGGCACACTATTCCAAAGGTTGG + Intergenic
1034344297 7:150376749-150376771 GGAAAGAGAGGTCCAAAGGACGG + Intronic
1034712431 7:153205440-153205462 TGAAAGAGTACTCCCAAGGAAGG + Intergenic
1034797325 7:154025978-154026000 GGGCACACTATTCCAAAGGTTGG - Intronic
1035165498 7:156987150-156987172 GGAAAGGCTTTTCCAGAGGCAGG + Intergenic
1035710843 8:1712661-1712683 GGGATGAAGATTCCAAAGGAAGG + Intergenic
1036133197 8:6135375-6135397 GGACAGACTTAACCAAAGGAGGG - Intergenic
1036766878 8:11554993-11555015 GGAAAGATTATCCCAAAGTTAGG + Intronic
1037363308 8:18096458-18096480 GGAAAGAACATTCCAAACAAAGG - Intergenic
1037693018 8:21198636-21198658 AGAATTACTATTTCAAAGGATGG - Intergenic
1038159018 8:25019105-25019127 GGAAAGACTAGTCCAATGAAAGG + Intergenic
1038259828 8:25983192-25983214 GGAAATACTATTCCATTGGGTGG - Intronic
1039384050 8:37115856-37115878 GCAAAGCCTAATCCAAAGAAAGG - Intergenic
1040055607 8:43054953-43054975 GAAAAGAATATCCCAAATGAAGG - Intronic
1041794929 8:61737250-61737272 GGAACCACTAGTCCAAGGGAAGG - Intergenic
1042081036 8:65051068-65051090 GTAAAGACTGTTCCAACAGAAGG + Intergenic
1042146466 8:65735278-65735300 TGAAAGGCTATTTTAAAGGATGG - Intronic
1042491187 8:69400025-69400047 GAATATACAATTCCAAAGGAGGG - Intergenic
1043501057 8:80856594-80856616 GGAAAGACTATTCATCTGGAAGG - Intronic
1043702377 8:83305228-83305250 GGAAAGACTATTCCAGGGAAAGG - Intergenic
1046153258 8:110256166-110256188 GGGAAGAATCTTCCAGAGGAAGG - Intergenic
1046363674 8:113196314-113196336 TGAAAGACTATTCAGAAGAAGGG + Intronic
1046990462 8:120447009-120447031 GGAAAGATTTTTACAAAGTACGG - Intronic
1047435032 8:124829170-124829192 GGAAAGACTGTGACTAAGGAAGG + Intergenic
1050046942 9:1556739-1556761 AGGAAGAATATTCCAAAAGAAGG + Intergenic
1050141468 9:2520863-2520885 GGAAAGAAGCTTCCAGAGGAAGG - Intergenic
1051581116 9:18675603-18675625 GGAAATACCATTGCAAAGGGTGG - Intronic
1054695435 9:68356136-68356158 GGAAAGCCTATTTCTAAGGCAGG + Intronic
1055718258 9:79142463-79142485 GGCAAAACTATTCAAAAAGAAGG - Intergenic
1055885249 9:81055127-81055149 GGCAATAGTGTTCCAAAGGAGGG - Intergenic
1056323049 9:85454609-85454631 GGAAAGACTGTTTCAAACTATGG + Intergenic
1057053374 9:91942638-91942660 GGAAAGACTATTTCCAAATAAGG - Intronic
1058020398 9:100080149-100080171 GGAAAGAGTATTCTAAAAGTAGG - Intronic
1058540945 9:106012019-106012041 GGAAAGAGTGCTACAAAGGAGGG - Intergenic
1059783763 9:117558113-117558135 AGAAAGAGTATTCCACATGAGGG + Intergenic
1060114808 9:120931514-120931536 ACAAAGACTCTTCCAAAGGTGGG + Intergenic
1187258380 X:17661789-17661811 GGAAGGACAATTCCCAAAGAGGG - Intronic
1187794828 X:22992523-22992545 GGAAAGTCTGTTTAAAAGGAGGG - Intergenic
1188234946 X:27716860-27716882 GGAGAGAGTATTAGAAAGGATGG - Intronic
1188785598 X:34342252-34342274 GAAAAGATTATTGCAAAGTAGGG - Intergenic
1189590730 X:42507812-42507834 GGAAAGAAGCTTCCAGAGGAAGG + Intergenic
1189687573 X:43581446-43581468 GGAGAGACTCTTCCAAACAAAGG + Intergenic
1189960818 X:46323387-46323409 GGACACACTACTCCAAAAGATGG - Intergenic
1192366365 X:70477181-70477203 GGCAAGTCGATTCCAAAGAAGGG + Intronic
1192379933 X:70605153-70605175 GGAAAGAGTGGTCCATAGGAAGG + Intronic
1193006242 X:76621470-76621492 GCAAAAACTATTCCAAAAAATGG + Intergenic
1193342857 X:80371739-80371761 TGAAAGCCTAATCCAAAGCAAGG - Intronic
1193369541 X:80677947-80677969 GGAAAGAACATTCCAGAGGAGGG + Intronic
1193775034 X:85630972-85630994 GGAAAGACCAGTCTAAGGGATGG - Intergenic
1194545241 X:95225751-95225773 GGGATGAAAATTCCAAAGGAAGG + Intergenic
1195288432 X:103408312-103408334 GTATAGACTAATCTAAAGGAAGG - Intergenic
1196682673 X:118484664-118484686 AGAAAAACTATTCCCAAGAAGGG - Intergenic
1198433870 X:136596186-136596208 GGGAAGACCATTTCAAAAGAAGG + Intergenic
1198513474 X:137378503-137378525 GGGAAGACCATTCTAAATGAGGG + Intergenic
1200945088 Y:8827029-8827051 GGAAAGAATATTCCAAGCAAGGG - Intergenic
1201518854 Y:14850055-14850077 GGAAATACTATTCCAATGTCAGG + Intergenic
1202391206 Y:24372454-24372476 GGAAAGAATATTCCACTTGAGGG + Intergenic
1202479578 Y:25297662-25297684 GGAAAGAATATTCCACTTGAGGG - Intergenic