ID: 972422286

View in Genome Browser
Species Human (GRCh38)
Location 4:38899986-38900008
Sequence CTATCTAAGCAGAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972422283_972422286 21 Left 972422283 4:38899942-38899964 CCTTATAAGCTCATACACTCTAT 0: 1
1: 0
2: 0
3: 1
4: 93
Right 972422286 4:38899986-38900008 CTATCTAAGCAGAAAGAGGCTGG No data
972422282_972422286 29 Left 972422282 4:38899934-38899956 CCACAGGACCTTATAAGCTCATA 0: 1
1: 0
2: 0
3: 5
4: 144
Right 972422286 4:38899986-38900008 CTATCTAAGCAGAAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972422286 Original CRISPR CTATCTAAGCAGAAAGAGGC TGG Intronic
No off target data available for this crispr