ID: 972422838

View in Genome Browser
Species Human (GRCh38)
Location 4:38905792-38905814
Sequence CTGATGAAGGGGAAGTGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972422838_972422849 13 Left 972422838 4:38905792-38905814 CCCACCCACTTCCCCTTCATCAG 0: 1
1: 0
2: 3
3: 32
4: 389
Right 972422849 4:38905828-38905850 GCTGTCTGCCATCACCAATGTGG 0: 1
1: 0
2: 0
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972422838 Original CRISPR CTGATGAAGGGGAAGTGGGT GGG (reversed) Exonic
900857880 1:5200562-5200584 GTGATGAAGGGAAAATGGGGTGG - Intergenic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901757605 1:11450861-11450883 CTGATGTAGGGGATGGGGGCAGG - Intergenic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
904832027 1:33311574-33311596 CTGATGAAGGGAGAGGGGCTGGG - Intronic
904918532 1:33987639-33987661 CTCATGAAGGAGATCTGGGTGGG - Intronic
905458718 1:38106729-38106751 CTGATGATGGGGTGGGGGGTGGG + Intergenic
905812146 1:40920516-40920538 GTGATGAAGAGGATGTGTGTGGG + Intergenic
907804043 1:57800722-57800744 CTGATGAAAGGGATTTGGGGTGG - Intronic
908266776 1:62387000-62387022 CTGATGAAATGGATCTGGGTTGG + Intergenic
909665499 1:78127786-78127808 CTGAGGTAGGGGAAGTGCTTGGG - Intronic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG + Intergenic
912563270 1:110565568-110565590 CTGGGGAAGGGGATGTGGGGTGG + Intergenic
913213306 1:116599595-116599617 GTGATGATGGTGCAGTGGGTGGG + Intronic
913543269 1:119842095-119842117 CTGACTAAGGGTAAGTGGGGTGG + Intergenic
914912465 1:151798959-151798981 CTAAAGAAGGGGAAGTTGCTGGG + Intergenic
915230708 1:154443484-154443506 GTGATGCAGTGGAAGTGGGCGGG - Intronic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915447881 1:155984501-155984523 CTGATCTAGGTGAAGCGGGTGGG - Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915585786 1:156843202-156843224 CTGATGAATGGGAGGTGCCTCGG - Exonic
916304781 1:163318179-163318201 CTCATGAATGCGAAGTGGGTAGG + Intronic
916415951 1:164592093-164592115 CAGATGAAGGGGATGGGGGTTGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
917246767 1:173011523-173011545 CAAATGAAGGGAAAGTGGGATGG + Intergenic
918068640 1:181118935-181118957 TTGATGAAGGGGATGTGACTTGG + Intergenic
918399326 1:184147692-184147714 CTGATAAAGGGGATCTGAGTGGG - Intergenic
919551433 1:198993946-198993968 ATTTTGAAGGGCAAGTGGGTGGG + Intergenic
919804956 1:201376008-201376030 CTGATGCAGGGGAAAGAGGTGGG + Intronic
920129481 1:203720738-203720760 CAGGTGAAGGGGGTGTGGGTGGG + Exonic
920202865 1:204270820-204270842 CTGGTGAAGGGGCAGAAGGTGGG - Intronic
920437034 1:205953675-205953697 CTGGTGAAGGGGGTGGGGGTGGG + Intergenic
920624631 1:207585081-207585103 CTGGTGGAGTGGAAGAGGGTGGG + Intronic
921391634 1:214621209-214621231 CAGATGCAGGGCGAGTGGGTTGG + Intronic
921940142 1:220830664-220830686 CTGAGAAAGGGGAAGTGACTTGG - Intergenic
922520433 1:226245895-226245917 CTAATTAGGGGGAAGTAGGTGGG - Intronic
923036824 1:230290329-230290351 CTGGAGAAGCGGTAGTGGGTAGG + Intergenic
923373688 1:233338861-233338883 TTGATGAAGGGGAACCAGGTTGG + Intronic
924444655 1:244118015-244118037 GTGAGGAAGGGGATTTGGGTGGG + Intergenic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063723200 10:8606161-8606183 CTTATGAAGAGGAAGAGAGTGGG + Intergenic
1064330531 10:14389924-14389946 CTGAAGAAGTGGTAGTTGGTAGG - Intronic
1065460012 10:25950702-25950724 CTGAGGAAGGAGAAATGAGTAGG + Intronic
1065730364 10:28704681-28704703 TTGATGAAGTGGAGGTGGTTTGG + Intergenic
1067338731 10:45384112-45384134 CTGATGCAGGGGGAGGGGGAAGG + Intronic
1067442596 10:46318020-46318042 CTGATGAAGAGGAGCAGGGTTGG - Intronic
1067833272 10:49622282-49622304 CTGATGGTGGGGGAGTGGGTTGG - Intronic
1070360171 10:75680664-75680686 ACGAGGAAGGGGAAGTAGGTAGG + Intronic
1070657167 10:78279528-78279550 TTTATGAAGGGGGATTGGGTGGG + Intergenic
1070983409 10:80667979-80668001 CTAATGAAGAGGAATTGGGCTGG - Intergenic
1071130768 10:82390915-82390937 CAGTTTAGGGGGAAGTGGGTTGG + Intronic
1071718224 10:88118130-88118152 GTGATGGAGGGAAAGTAGGTGGG + Intergenic
1072578351 10:96720137-96720159 CTGAAGAAGTGGGAGGGGGTCGG + Intronic
1074323140 10:112422022-112422044 ATAATGAAGGAGAGGTGGGTAGG + Exonic
1076578174 10:131485597-131485619 ATGTGGAAGGGGAAATGGGTAGG + Intergenic
1076822800 10:132948764-132948786 CTTATCAAGGGGAAGGAGGTAGG - Intergenic
1077133471 11:986757-986779 TGGAGGGAGGGGAAGTGGGTGGG - Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1081710565 11:45212974-45212996 CTGATGCTGGGGAAGCTGGTGGG - Intronic
1082000111 11:47389584-47389606 CTGAGGGTGTGGAAGTGGGTGGG - Intergenic
1082803607 11:57432404-57432426 TGGAGGATGGGGAAGTGGGTAGG + Intergenic
1083208643 11:61168698-61168720 CTGATGCAGGGGAAGGAGATGGG - Intergenic
1083987454 11:66225217-66225239 CTGCTGAAGGGTAAGAGTGTAGG - Intronic
1084058302 11:66652055-66652077 CTGATGAAGTGGCGATGGGTGGG + Intronic
1084148060 11:67275471-67275493 AGGAAGAAGGGGAAGGGGGTGGG - Intronic
1084578448 11:70006443-70006465 CAGAGGTAGGGGAGGTGGGTGGG - Intergenic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1085460572 11:76690569-76690591 CTGATGGGGTGGAAGTGGGTAGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087025616 11:93646624-93646646 CTGATGCAGTGGATGTGAGTTGG + Intergenic
1087504803 11:99005876-99005898 CTGTAGAAGGTGAGGTGGGTAGG - Intergenic
1088560257 11:111107755-111107777 CTGATAAAGAGGAAGTGGAGAGG - Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089376463 11:117998727-117998749 CTGATGAAGATGAAGGGGCTGGG - Exonic
1089625038 11:119745812-119745834 AGGATGAAGGGGAGGTGGGCAGG + Intergenic
1089682319 11:120125557-120125579 CTGAGGAAGGGTGGGTGGGTGGG + Intronic
1090461840 11:126897937-126897959 CTTGGGAAGGGGGAGTGGGTGGG + Intronic
1091236340 11:134024797-134024819 ATGGTGAGGGGGAAGAGGGTGGG - Intergenic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1091918947 12:4289202-4289224 CAGATGAAGGGGGTGGGGGTGGG + Intronic
1092483383 12:8880624-8880646 CTGGTGAACGGGGAGTGGGAGGG + Intronic
1093443205 12:19224426-19224448 CTGATAATGGGCAAGTGAGTGGG - Intronic
1094498421 12:31003604-31003626 CTGATGTGGGTGGAGTGGGTAGG - Intergenic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096530489 12:52239603-52239625 CTAAGGAAGGGGGATTGGGTGGG + Intronic
1100383002 12:94079168-94079190 CTGATGAAGAGGAATGGGGTGGG + Intergenic
1101969699 12:109304528-109304550 CTGATGAAGGGGCAGGGGACTGG - Intronic
1102029665 12:109732670-109732692 CAGAAGGAGGGGAGGTGGGTGGG + Intronic
1102235758 12:111293570-111293592 GTGAGGAAGGGAAGGTGGGTGGG + Intronic
1102404091 12:112657778-112657800 ATGAAATAGGGGAAGTGGGTAGG + Intronic
1102600342 12:114025024-114025046 CTTATGAAGGGGAAAGGGGTGGG - Intergenic
1102634158 12:114308182-114308204 TAGATGAAAGGTAAGTGGGTAGG - Intergenic
1103193285 12:119020581-119020603 CTGACGGAGGGGGAGTGAGTCGG + Intronic
1103782405 12:123407725-123407747 TTGAAGAAGGGAAAGTGGGGCGG - Exonic
1104548272 12:129732152-129732174 CTGAGGAAGGGCAAGTGGCTGGG - Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1105217691 13:18298755-18298777 TTGAAGAAGGGAAAGTGGGGCGG - Intergenic
1106116010 13:26818203-26818225 CTGCAGAAAGGGAAGTGGATAGG - Intergenic
1106158212 13:27176966-27176988 CTGATGAAGGTCAAGTGGCAAGG - Intergenic
1106361427 13:29034837-29034859 CTGATGAAGGTGCAGTGGTGGGG - Intronic
1107278817 13:38709210-38709232 CTCATGCAGAGGAAGTGGGCAGG - Intronic
1108020542 13:46123692-46123714 GTGATGAATGAGAAGTGGGCAGG - Intergenic
1108711124 13:53033468-53033490 CTGATGAAAAGGAATTGGATTGG + Intronic
1110463223 13:75770315-75770337 ATGTTGATGGGGATGTGGGTGGG + Intronic
1112804160 13:103144559-103144581 CTTCTGAATGGGAATTGGGTGGG + Intergenic
1113472848 13:110559077-110559099 CTGAAGAGGGGGAAGAGAGTTGG - Intronic
1113510930 13:110854260-110854282 CTGATGAGGGGCAGGTGTGTGGG - Intergenic
1115641443 14:35337923-35337945 CTAATGAAGGAGAGGTGGGAGGG + Intergenic
1115983329 14:39077645-39077667 GTGAGGAAGGGGAAGTAGATTGG - Intronic
1118620427 14:67609785-67609807 GAGAAGAAGGGGAAGGGGGTGGG + Intergenic
1120082540 14:80232050-80232072 CTTAAGAAGGAGAAATGGGTTGG - Intronic
1120256245 14:82123033-82123055 GTGATCAAGGGGAAGAGGGTGGG + Intergenic
1122267112 14:100551862-100551884 GTGGGGAAGGGGAAGTGGGTCGG + Intronic
1126460800 15:48913273-48913295 CTGCTGTGGGGGATGTGGGTGGG + Intronic
1126695113 15:51319172-51319194 CTGATTAAGGGAAAGGGTGTAGG - Intronic
1126767268 15:52021261-52021283 TTGCTGAAGGGGATGGGGGTCGG + Intronic
1127945561 15:63747725-63747747 TTGATGAAGGGAAAGGGAGTGGG + Exonic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128105759 15:65043556-65043578 GTGATGAGGGGGAAGTGGCATGG - Intergenic
1128801785 15:70501685-70501707 CTGATCAAGGGGAAGGGGTTGGG + Intergenic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1130053687 15:80504813-80504835 CTCAGGGAGGGGAAGTGGCTGGG + Intronic
1130668145 15:85886956-85886978 CAGTAGAAAGGGAAGTGGGTTGG + Intergenic
1130782105 15:87051119-87051141 CTGCTGAAGGGGAAGAGGTGGGG + Intergenic
1132089276 15:98934833-98934855 CTGATGAGTGGGAGGTGGCTCGG + Exonic
1132246423 15:100299786-100299808 GTGATGAAGGTGAAGAGTGTGGG - Intronic
1132416349 15:101622181-101622203 AGGATCCAGGGGAAGTGGGTGGG - Intronic
1132715783 16:1289220-1289242 CTCATACAGAGGAAGTGGGTGGG + Intergenic
1132827883 16:1914057-1914079 CTTCTGAAGTGGCAGTGGGTGGG - Intronic
1133275996 16:4638823-4638845 CCGAGGAAGGGGGAGTGGGAAGG - Intronic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135775372 16:25253382-25253404 CTGGGGAAGGGAAAGGGGGTAGG - Intronic
1136450772 16:30353331-30353353 CAGAGGAGGGGGCAGTGGGTAGG - Intronic
1137476844 16:48816815-48816837 CTGAGGAAGGGGTTGTGGGTGGG + Intergenic
1138302080 16:55938906-55938928 CTAATGCAGAGGAAGTGGGGTGG + Intronic
1138583019 16:57953778-57953800 CTGATGACGGGGTAGAGGCTGGG - Intronic
1138710762 16:58967941-58967963 TTGAGGATGGGGAAGAGGGTGGG - Intergenic
1139389595 16:66598361-66598383 CTGAAAGAGGAGAAGTGGGTGGG - Intergenic
1139956929 16:70697612-70697634 ATGATGATGGGGGAGTGGGCAGG + Intronic
1140032156 16:71347451-71347473 CTGATGCATGGGATGTGGGCTGG - Intergenic
1140516947 16:75550133-75550155 GAGAAGAAGGGGAAGCGGGTGGG + Intronic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1141248307 16:82331555-82331577 ATGAAGAAGAGGAAGTGGGTTGG + Intergenic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1141672046 16:85497238-85497260 CTCCTGAAGGCGGAGTGGGTGGG + Intergenic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1142968353 17:3594914-3594936 CTGAAGAACGGGAAGTCAGTGGG + Intronic
1143016595 17:3893859-3893881 CTAAGGGAGGGGAAGTGGGGTGG - Intronic
1143031887 17:3972564-3972586 GTGGTGAAGGGGAAGTGGCGGGG + Intergenic
1143070991 17:4293137-4293159 CTGCTGGAGGGGAGGTGGGGGGG - Intronic
1143254193 17:5543684-5543706 CTGAGGAAGTGGAGGTGGCTGGG + Intronic
1143843164 17:9750880-9750902 TAGATGAAAGGGAAGTGGTTGGG - Intergenic
1145774479 17:27518515-27518537 ATGATGAATGGGCACTGGGTGGG - Intronic
1146064447 17:29623323-29623345 CTGATGTAGGGCAAGTGAGAGGG + Intergenic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1147615532 17:41825152-41825174 CTGATTCAGGGGATGTGGGTGGG - Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148591274 17:48818185-48818207 CAGGTGAAGGGGATCTGGGTTGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149864751 17:60145123-60145145 GTGATGAGGGGGAATTGGGTTGG - Intergenic
1150457336 17:65317372-65317394 ATGAGGAAGGGGAAGGGGCTTGG + Intergenic
1150567545 17:66355302-66355324 CTGATGAAAGGGAGGTGGTGAGG + Intronic
1150642599 17:66959738-66959760 CTGATGGAGGGGAGGCTGGTAGG + Intergenic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151839213 17:76605418-76605440 CTGATAAAGGGCATTTGGGTGGG + Intergenic
1152770227 17:82163042-82163064 CTGAGGAAGGGGCTGTGGGGAGG - Intronic
1152893460 17:82896090-82896112 CTGAAGAAGGGGGTGTGGGAGGG - Intronic
1153782562 18:8506978-8507000 GTGAGTAAGGGGAAGTGGTTTGG + Intergenic
1154239276 18:12637698-12637720 CTGTTGAAGGGGAATGGGCTTGG - Intronic
1155099799 18:22599339-22599361 CTGATGCTGGGGGAGTAGGTGGG - Intergenic
1155217579 18:23657028-23657050 CTGATGGAGGGGCAGTGGCCTGG - Intronic
1156241298 18:35257275-35257297 TTGGTAAAGGGGAACTGGGTGGG - Intronic
1156482055 18:37442510-37442532 CTGAGGAAGGGAAGGTGGCTGGG + Intronic
1158724459 18:59957153-59957175 AGGCTGAAGGTGAAGTGGGTTGG - Intergenic
1159725491 18:71952403-71952425 CTTATGAGTGGGAGGTGGGTTGG + Intergenic
1161306435 19:3571800-3571822 TTGAGGAAGAGGAAGTGGGCCGG + Intronic
1162088241 19:8261353-8261375 CTGATGAAGGGGAGGTGATGGGG + Intronic
1162478580 19:10915263-10915285 CTGATGGTGGGGATGGGGGTGGG + Intronic
1163742250 19:19022624-19022646 CTGTGGGAGGGTAAGTGGGTGGG + Intronic
1165428375 19:35757791-35757813 CTGTTGCAGGGGCAGTGGGGCGG - Intronic
1166507531 19:43380392-43380414 CTGGCCAAGGGGATGTGGGTAGG + Intergenic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167521639 19:49959152-49959174 CTGAGGTGGGGGAAGTGGGTGGG + Intronic
1167523742 19:49971570-49971592 CTGAGGTGGGGGAAGTGGGTGGG - Intergenic
1167756322 19:51415690-51415712 CTGAGGTGGGGGAAGTGGGTGGG + Intronic
1168063186 19:53905653-53905675 GAGATGAAGGGGAAGAGGGAGGG - Intronic
1168503865 19:56916391-56916413 CCTATGAAGGGGCAGTGGCTAGG + Intergenic
925084557 2:1097845-1097867 GTGGTGAAAGGGAAGTGGGGCGG - Intronic
925411495 2:3642437-3642459 CTGATGAGAGGGACATGGGTGGG - Intronic
925412498 2:3648015-3648037 CTGATGATGGTGCAGTGGGCAGG + Intergenic
926226840 2:10972922-10972944 CTGGTGCAGGGGAAGCGGGGTGG + Intergenic
927894881 2:26775291-26775313 GGGATGAAGTGGAGGTGGGTGGG - Intronic
928217382 2:29373051-29373073 CTGGTGATGGGGAAGGGGCTTGG - Intronic
930381725 2:50638216-50638238 TTGTTAAAGTGGAAGTGGGTAGG - Intronic
931198810 2:60077399-60077421 CAGATGTATGGGAAGTGGGAGGG + Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933917761 2:87013582-87013604 CTGAAGAAATAGAAGTGGGTTGG - Exonic
934005235 2:87756332-87756354 CTGAAGAAATAGAAGTGGGTTGG + Exonic
934296617 2:91747896-91747918 TTGAAGAAGGGAAAGTGGGGCGG + Intergenic
935768192 2:106390426-106390448 CTGAAGAAATAGAAGTGGGTTGG + Intergenic
936714841 2:115174190-115174212 CTGATGAAGTAGAAGAGAGTAGG + Intronic
939916212 2:148046990-148047012 ATCTTGAAGAGGAAGTGGGTTGG - Intronic
940023540 2:149181125-149181147 CAGATGAAGGGGAATTGAGAGGG - Intronic
940134460 2:150420792-150420814 CAGAAGAATGGGCAGTGGGTAGG + Intergenic
941132478 2:161670688-161670710 CTAATAAAGGGAAATTGGGTTGG - Intronic
941999796 2:171634450-171634472 CTAATGAATGGGCAGTGAGTAGG + Intergenic
944384242 2:199147189-199147211 CTGATTAGGGGGAAGGGAGTTGG - Intergenic
945039859 2:205734533-205734555 CAGATGCAAGGGAAGGGGGTGGG + Intronic
945170447 2:206989585-206989607 CTGATGAAAGGTAGGAGGGTGGG + Intergenic
945250337 2:207760547-207760569 CTGATGAGAGGCAGGTGGGTTGG - Intronic
945802560 2:214451283-214451305 CTAAGGAAGGATAAGTGGGTCGG + Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946544448 2:220722315-220722337 CTGATGATGGGCATTTGGGTTGG + Intergenic
948609885 2:239160021-239160043 CTGATGAAAGGGCAATGGTTTGG - Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169996602 20:11564528-11564550 CAGGTGAAGGGGATCTGGGTGGG - Intergenic
1171251810 20:23654583-23654605 CTGATGGAGGGCAAGGGAGTGGG + Intergenic
1172144841 20:32749671-32749693 GGGATGTAGGGGATGTGGGTTGG - Intergenic
1172567929 20:35945559-35945581 TTGATGAAGAGGTACTGGGTGGG + Intronic
1173357595 20:42308510-42308532 CTTCTGAGGGGGAAGAGGGTTGG - Intronic
1173564030 20:44026691-44026713 TTGATGAAGGGGGTGTGGGGAGG - Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176902854 21:14464512-14464534 CTGAAGAAGAGGCAGTGGGGAGG + Intergenic
1176942795 21:14944250-14944272 CACATGAAGGCCAAGTGGGTTGG - Intergenic
1178035472 21:28577790-28577812 ATGATGAATTGGATGTGGGTAGG - Intergenic
1179318476 21:40268291-40268313 CTGCTGATGGGCAAATGGGTGGG + Intronic
1181019372 22:20090947-20090969 CTGAGGATGGGGAAGTGGCCCGG + Intronic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181483684 22:23217616-23217638 CTGAAGTTAGGGAAGTGGGTGGG + Intronic
1181671034 22:24425489-24425511 CGGATGGAGGGGTAGTGGCTGGG - Intronic
1182950802 22:34373888-34373910 CTGATAAAGGAGAACTGGCTCGG + Intergenic
1183414936 22:37676564-37676586 CTGCTGGAGAGGAAGTGGCTAGG - Intronic
1184726521 22:46350545-46350567 CTGGAGAAGGGGAAGTGGTGCGG - Intronic
1185340419 22:50288449-50288471 CTGATGGAAGGGACCTGGGTTGG - Intronic
949157357 3:845551-845573 CTGCTGCAGGGGCAGTGGGAGGG - Intergenic
949414104 3:3798704-3798726 CCGAGGAAGGGGAGGAGGGTGGG - Intronic
950634785 3:14307239-14307261 GGGATGCAGGGGAGGTGGGTTGG + Intergenic
950717646 3:14861151-14861173 CTGAAGACGGGGGAGTGGCTCGG + Intronic
950950435 3:16992777-16992799 CCCATGAAGGGGCAGAGGGTAGG + Intronic
951019505 3:17767113-17767135 TTGATGAAGGGTGGGTGGGTGGG - Intronic
951242826 3:20306573-20306595 CTGATGTAGGGAAAGTGAGTGGG - Intergenic
951804691 3:26631396-26631418 CTGATAACTGGGAAGTGGGAAGG - Intronic
952238822 3:31508758-31508780 TTGAGAAAGAGGAAGTGGGTAGG + Intergenic
952331238 3:32366230-32366252 ATGGGGAAGGGGAAGAGGGTTGG - Intronic
952885659 3:38009771-38009793 CTGCTGAAGGGGAAGAAGCTCGG - Exonic
952983348 3:38756163-38756185 CTGGTGAAAGGGATCTGGGTGGG - Intronic
953239685 3:41137725-41137747 CTGATTCTGGGGAAGTGTGTGGG - Intergenic
953913069 3:46902475-46902497 TTGTTGAAGGGGAAGTGGCTTGG + Intronic
953990125 3:47477068-47477090 CTGAAGAATGTGTAGTGGGTCGG - Intronic
954111783 3:48437650-48437672 TTGAGGAAGGGGCAGTTGGTAGG - Intronic
956488390 3:69745451-69745473 CAGAGGAAGGGGAACTGGGGAGG + Intronic
956627982 3:71285757-71285779 CTGATGTAGTGGAAGAGGCTGGG + Intronic
956833621 3:73077478-73077500 CTGAGGAAGGGGAATTTGATAGG - Intergenic
957215459 3:77314834-77314856 CTGCTGTAGGGAATGTGGGTAGG + Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957741665 3:84278663-84278685 TGGAGGAAGGGGAAGAGGGTAGG + Intergenic
957821816 3:85386369-85386391 CTGGAGAATGGGAATTGGGTGGG + Intronic
959663484 3:108895716-108895738 GTGATGAAGGGAAATTGGGAGGG + Intergenic
961786280 3:129348985-129349007 CTGAGAAAGGGGAAGTGAGTAGG + Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962422505 3:135240861-135240883 TTGCTGCAGGGGAGGTGGGTGGG - Intronic
962434282 3:135350205-135350227 CTGAGGGAGGGTACGTGGGTTGG - Intergenic
963627168 3:147688482-147688504 ATGATGATGGAGAAGTGGGTAGG - Intergenic
965655377 3:170977768-170977790 ATTATGCAGGGGAAGGGGGTAGG + Intergenic
965888272 3:173476724-173476746 TCCATGAAGGGTAAGTGGGTGGG + Intronic
966105703 3:176330816-176330838 CTTATGAATGGCAAGTGGGGTGG - Intergenic
966920080 3:184605335-184605357 CTGAAGAAGGCCTAGTGGGTGGG + Intronic
967078109 3:186023533-186023555 CTGAGAAGGTGGAAGTGGGTGGG + Intergenic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
968683489 4:1938625-1938647 CTGGTGAAGGGGAACAGGGCAGG + Intronic
969148092 4:5141811-5141833 CTGAGGAAGGTGGAGGGGGTGGG - Intronic
969834383 4:9828184-9828206 CTGATGGAGCAGATGTGGGTGGG - Intronic
970647793 4:18142658-18142680 CTGGGGAAGTTGAAGTGGGTGGG - Intergenic
971188229 4:24401798-24401820 CTGATGAGAGGTGAGTGGGTTGG + Intergenic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
972637783 4:40899603-40899625 ATGAAGAAGGGCAAGTGGCTGGG + Intronic
973059000 4:45695798-45695820 CTGAAGAAGTGGTAGTTGGTAGG - Intergenic
975228172 4:71899211-71899233 CTGTTGAAGGGGTAGATGGTGGG - Intergenic
975701023 4:77066818-77066840 CTGAAGAAGTGGGAATGGGTAGG - Intronic
977071168 4:92389715-92389737 CTGATGATATGGAACTGGGTAGG + Intronic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
978961998 4:114691342-114691364 CTGAAGCAGGGAAGGTGGGTAGG - Intergenic
979488558 4:121297542-121297564 AGGATGAAGGGGAAGTGCTTAGG - Intergenic
980864219 4:138535739-138535761 CTGATGAATGGGATTTAGGTTGG + Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
983272216 4:165575715-165575737 CAGAAGAAGGGGAAGTGACTGGG + Intergenic
983648082 4:170011989-170012011 CAGAGGAGGGGGAAGTAGGTTGG + Intronic
985091647 4:186369200-186369222 CTGATGAAGGTGATGATGGTGGG + Intergenic
985870321 5:2549236-2549258 CTGCTGAAGGGCATGTGGGATGG - Intergenic
986287502 5:6370699-6370721 TTGATGCAGGTGAAGTGTGTGGG + Intergenic
986447063 5:7830948-7830970 GTGATGACGGGGCACTGGGTGGG + Exonic
986581450 5:9270685-9270707 CTGATGTTGGGGCAGCGGGTGGG + Intronic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
987441010 5:17956593-17956615 CTGATGAGGAGGAAGTGGTGTGG + Intergenic
988982657 5:36587018-36587040 CTGGTGAAGGGGAAGAGGCTTGG - Intergenic
989624920 5:43420134-43420156 CTGAGGAAGGAGGAGTGGGGCGG - Intergenic
991042976 5:62194619-62194641 CCTCAGAAGGGGAAGTGGGTAGG - Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991405282 5:66295205-66295227 CTGATGAAGGGGTGGAGGGAGGG + Intergenic
992030220 5:72713648-72713670 ATGAAGAGGGGAAAGTGGGTAGG - Intergenic
992324656 5:75648909-75648931 TTGATGATGGGGAGGTGGGAGGG - Intronic
992325606 5:75656666-75656688 ATGATGAAGGGAATGGGGGTGGG + Intronic
993754982 5:91717472-91717494 CTGATGATGGGCATTTGGGTTGG - Intergenic
997693242 5:135842288-135842310 CTGGGGTAGGGGGAGTGGGTGGG - Intronic
997826916 5:137114611-137114633 CTGATAAAGGGATGGTGGGTGGG + Intronic
998007192 5:138664909-138664931 CTGAGCAAGAGGTAGTGGGTGGG + Intronic
998210250 5:140191434-140191456 ATGATGAGGGGTAAGTGGGGAGG + Intronic
1000211810 5:159114229-159114251 CAGATGAAAGGGAAGTGAATAGG + Intergenic
1000834134 5:166134293-166134315 TTGATGAAGGGACAGTGGGTCGG + Intergenic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001270773 5:170309923-170309945 CAAAAGAAGGGGCAGTGGGTAGG + Intergenic
1001543977 5:172558703-172558725 GTGTGGAAGGGGAACTGGGTGGG - Intergenic
1001735366 5:173994058-173994080 CTGAAGAAGTGGTAGTTGGTTGG + Intronic
1003494680 6:6653786-6653808 CTGAGGAAACGCAAGTGGGTGGG - Intronic
1004317173 6:14599725-14599747 CTGAGGAAGGAGAGGTGGGGAGG + Intergenic
1005887321 6:30106726-30106748 CTGATGAAGTGGAAAGGGCTGGG + Intronic
1006192337 6:32217267-32217289 CTGGTGGGGCGGAAGTGGGTGGG + Intronic
1006355385 6:33553719-33553741 CTGAGGAATTGGAAGTGGTTGGG - Intergenic
1006509403 6:34513757-34513779 CTGCTGAAGGGGGATGGGGTGGG - Intronic
1006844000 6:37050304-37050326 CCGAGGAAGGGGAAGTGGCGGGG - Intergenic
1007246449 6:40466647-40466669 ATGAAGAAGTGGAAGTGGATTGG - Intronic
1007789638 6:44301666-44301688 ATGATGAAAGGGAAGTGGTGAGG - Intronic
1008126242 6:47672671-47672693 AAGATGGAGGGGAGGTGGGTGGG - Intronic
1008137178 6:47790367-47790389 CCCCTGAAGGGGAAGTAGGTAGG - Intronic
1008846614 6:55973239-55973261 ATGAGGAAGGGAAAGTGAGTAGG - Intergenic
1008884469 6:56417287-56417309 CTGATTACAGGGAAGTGGGCTGG - Intergenic
1012622469 6:101362970-101362992 CTGATGAAGTAGTATTGGGTAGG - Intergenic
1012906514 6:105073107-105073129 CTGGTGGTGGGGAGGTGGGTGGG - Intronic
1013182881 6:107732749-107732771 CTGGGGGAGGCGAAGTGGGTGGG + Intronic
1014367751 6:120565149-120565171 CTGTTGGAGGAGGAGTGGGTGGG + Intergenic
1014548925 6:122765719-122765741 CAGATGAAAGGGAGGTGGGGAGG - Intergenic
1015486819 6:133781002-133781024 AAGAAGAAAGGGAAGTGGGTAGG + Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1017234336 6:152103881-152103903 CTGATGAATTGGGAGGGGGTGGG + Intronic
1017295509 6:152789418-152789440 CTGGTGAAGGTGATCTGGGTGGG - Intergenic
1018129035 6:160710601-160710623 CTGAAGAAATAGAAGTGGGTTGG + Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018711021 6:166498322-166498344 CTGATGGTGGGGATGTGGGATGG + Intronic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019212849 6:170420544-170420566 CTGCTGGAGGGTAACTGGGTTGG - Intergenic
1019467296 7:1196579-1196601 GTGATGAAGGGGGGGCGGGTGGG + Intergenic
1020019480 7:4854313-4854335 CTGATGAGGGGGCATTAGGTGGG + Intronic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022157007 7:27670860-27670882 AAGATGAATTGGAAGTGGGTTGG - Intergenic
1022487842 7:30794193-30794215 CTGATGGAGGGGAGTTGGGAAGG - Intronic
1023626675 7:42121720-42121742 CTGATGGAGGGGGAGGAGGTGGG - Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1025739616 7:64184181-64184203 CTGATGAGGGGTCAGTGTGTGGG + Intronic
1026456850 7:70580293-70580315 CTGCTGAATGGGAATGGGGTAGG + Intronic
1026558610 7:71429263-71429285 CTGAAGAAGGAGGCGTGGGTGGG + Intronic
1027853844 7:83483931-83483953 CTGTTGACCTGGAAGTGGGTCGG - Intronic
1029284693 7:99457622-99457644 CTGATGAAGAGGAAGCAGGGAGG + Intronic
1030428178 7:109406994-109407016 TTGATGGGGGGGGAGTGGGTCGG + Intergenic
1031124249 7:117755849-117755871 CTGTTGAATGGGATGTGGGCAGG + Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1032122723 7:129168723-129168745 CCGATGCAGGGGAATGGGGTGGG - Exonic
1033431491 7:141293513-141293535 ATGATGAGGGGGAAGTGGAATGG + Intronic
1034071684 7:148192046-148192068 CTGAGGAGTGGGAAGTGGGGAGG + Intronic
1034557639 7:151860180-151860202 CTGGAGAAGGGGCAGTGGCTGGG - Intronic
1034573568 7:151978487-151978509 CTGATTAAGGAGATTTGGGTAGG - Intronic
1035035483 7:155891582-155891604 ATGGTGAAGGGGATGGGGGTAGG + Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1035854467 8:2959393-2959415 CTGATAGAGAGGAAGTGGGCTGG - Intronic
1036020465 8:4839154-4839176 CTGATGAAGGGAAAGAAGGATGG - Intronic
1037733629 8:21549688-21549710 CTGATGAAGCTGCTGTGGGTAGG - Intergenic
1037784527 8:21894791-21894813 CTGATGAGGGCTATGTGGGTAGG - Intergenic
1037915555 8:22770708-22770730 CTGATCAAGGAGAGGTGGGATGG - Intronic
1039193389 8:35002508-35002530 CTCAGCAAGTGGAAGTGGGTGGG - Intergenic
1041073273 8:54145845-54145867 CTGTTGTAGGTGAAGTAGGTAGG + Intronic
1042076280 8:64998501-64998523 CTGAGGAAGAGGAATTTGGTGGG - Intergenic
1042190282 8:66178831-66178853 AGGAGGAAGGGGAAGTGGGAAGG + Intergenic
1044227605 8:89736983-89737005 CTGCTGTAGGGGATGGGGGTGGG - Intergenic
1045097934 8:98817496-98817518 CTTTAGAAGAGGAAGTGGGTAGG - Intronic
1045440224 8:102201712-102201734 TTGTTGCTGGGGAAGTGGGTGGG - Intergenic
1045476326 8:102555830-102555852 CTGCAGAAGTGGAAGTGAGTTGG + Intronic
1046070911 8:109252160-109252182 ATGGTGAGGGGGATGTGGGTTGG + Intronic
1046932846 8:119858300-119858322 CAGATGGAGGGGCAGTGGGAAGG - Intergenic
1047021210 8:120776694-120776716 CTTATGAGGGGGAAGCAGGTGGG - Intronic
1048027694 8:130601771-130601793 CTGGTGTGGGAGAAGTGGGTGGG - Intergenic
1048517830 8:135126428-135126450 CAGAGGGAGGGGAATTGGGTGGG - Intergenic
1049002203 8:139833279-139833301 CTAAGGAAGGGGAAGTCGGCTGG - Intronic
1050516751 9:6452541-6452563 CTAAAGATGGGGAAGTGTGTTGG + Intronic
1051965331 9:22821576-22821598 CTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1054734081 9:68732896-68732918 CTGGTGATGTGGAGGTGGGTTGG + Intronic
1055934429 9:81591596-81591618 CATATGAAGGGGCTGTGGGTGGG + Intronic
1055945845 9:81689946-81689968 CTGATGATGGGAAGGTCGGTGGG + Intergenic
1058862058 9:109126260-109126282 GGGATGAGGGGGAAGTAGGTAGG - Intergenic
1059225268 9:112666878-112666900 TGAATGAAGAGGAAGTGGGTTGG - Intronic
1059733061 9:117075482-117075504 CAGATGGAGGGGAAGGGGGAGGG + Intronic
1060405030 9:123368832-123368854 CTGAGGCTGGGGAAGTGGGGAGG - Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060964554 9:127705482-127705504 CTGATGAAGGCGAGGAGGGCAGG + Intronic
1061710786 9:132486390-132486412 CTGATTAAGAGGAGGTGTGTGGG - Intronic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062438355 9:136557084-136557106 CTCATGCTGGGGATGTGGGTGGG - Intergenic
1185867937 X:3639466-3639488 TGGATGAAGGGGTAGGGGGTGGG + Intronic
1187483313 X:19678136-19678158 CTGATGAAGGCAAAGTTGGAAGG - Intronic
1188456146 X:30368645-30368667 CTGAAAGAGAGGAAGTGGGTAGG + Intergenic
1188471287 X:30542528-30542550 CTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1188925242 X:36033277-36033299 TTGATGAAGAGGAATTTGGTGGG + Intergenic
1189385229 X:40531553-40531575 TGGAGGAAGGGGAAGGGGGTTGG + Intergenic
1189416205 X:40816594-40816616 CTGTTGAATGGAAAGTGGGATGG - Intergenic
1189602781 X:42645226-42645248 CTGCTGAAGGGGAATTGTGGGGG + Intergenic
1189943818 X:46156290-46156312 CTTATGAAAGGGGAGGGGGTGGG + Intergenic
1190511037 X:51174714-51174736 CTGAAGAGGGGGAAATGGGAAGG + Intergenic
1192756798 X:74055161-74055183 CTGATCATGGTCAAGTGGGTTGG + Intergenic
1193399056 X:81020825-81020847 CTGGTGAAGAGGAGGTGGTTGGG + Intergenic
1195375208 X:104219860-104219882 TTGGTGAAGTGGGAGTGGGTTGG + Intergenic
1197727029 X:129783190-129783212 CTGATGATGGGATGGTGGGTGGG - Intronic
1199030582 X:142994272-142994294 GTGATCAAAGGGAAGTGAGTGGG + Intergenic
1199559841 X:149150951-149150973 CTGGTGAAGAGCAAGAGGGTGGG + Intergenic
1200063109 X:153492303-153492325 CTGAGGAGGGGGGAGTGGGAGGG + Intronic
1200259837 X:154608251-154608273 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200266791 X:154650489-154650511 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1201458929 Y:14201326-14201348 ATAAGGAAGGGGAAGTGGGGAGG + Intergenic