ID: 972427181

View in Genome Browser
Species Human (GRCh38)
Location 4:38944532-38944554
Sequence CGTGGCACTGGTTAGGAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972427170_972427181 4 Left 972427170 4:38944505-38944527 CCCCCAGGCCACAGACCAGTACC 0: 16
1: 56
2: 148
3: 326
4: 707
Right 972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 84
972427168_972427181 8 Left 972427168 4:38944501-38944523 CCCACCCCCAGGCCACAGACCAG 0: 20
1: 90
2: 203
3: 460
4: 1167
Right 972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 84
972427167_972427181 9 Left 972427167 4:38944500-38944522 CCCCACCCCCAGGCCACAGACCA 0: 3
1: 28
2: 98
3: 326
4: 1152
Right 972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 84
972427172_972427181 2 Left 972427172 4:38944507-38944529 CCCAGGCCACAGACCAGTACCAG 0: 22
1: 60
2: 173
3: 346
4: 790
Right 972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 84
972427169_972427181 7 Left 972427169 4:38944502-38944524 CCACCCCCAGGCCACAGACCAGT 0: 1
1: 2
2: 10
3: 50
4: 398
Right 972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 84
972427174_972427181 -4 Left 972427174 4:38944513-38944535 CCACAGACCAGTACCAGTCCGTG 0: 11
1: 96
2: 225
3: 505
4: 922
Right 972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 84
972427173_972427181 1 Left 972427173 4:38944508-38944530 CCAGGCCACAGACCAGTACCAGT 0: 28
1: 50
2: 147
3: 250
4: 525
Right 972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 84
972427171_972427181 3 Left 972427171 4:38944506-38944528 CCCCAGGCCACAGACCAGTACCA 0: 21
1: 49
2: 151
3: 264
4: 684
Right 972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972427181 Original CRISPR CGTGGCACTGGTTAGGAACC AGG Exonic