ID: 972427452

View in Genome Browser
Species Human (GRCh38)
Location 4:38947242-38947264
Sequence TACAAGGTAGGGGCCTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972427447_972427452 6 Left 972427447 4:38947213-38947235 CCTTCGGCAGGCTGAAGTAAAGT No data
Right 972427452 4:38947242-38947264 TACAAGGTAGGGGCCTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972427452 Original CRISPR TACAAGGTAGGGGCCTGAAT AGG Intergenic
No off target data available for this crispr