ID: 972431987

View in Genome Browser
Species Human (GRCh38)
Location 4:38991739-38991761
Sequence AAATATAAAATACAGTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1134
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 1053}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972431987 Original CRISPR AAATATAAAATACAGTTAGG TGG Intronic
900267987 1:1769387-1769409 AAATACAAAAAACAATTAGCCGG + Intronic
900597170 1:3485768-3485790 AAAAATAAAAAAAAGTTAGCTGG + Intergenic
901065794 1:6493815-6493837 AAATATAAAAAATAATTAGCCGG - Intronic
901477719 1:9502276-9502298 AAATAAAAAATAAAATCAGGAGG + Intergenic
901537492 1:9891961-9891983 AAATACAAAATAAAATTAGCTGG - Intronic
901589462 1:10328026-10328048 AAATTTAAAAAACAATTAGCTGG + Intronic
901865320 1:12102821-12102843 ACATAAAAAGTACAGCTAGGCGG - Intronic
901924710 1:12558846-12558868 AAATATAAAAAATAGACAGGAGG + Intergenic
902006832 1:13238881-13238903 AAATACAAAAAAAAATTAGGTGG + Intergenic
902118342 1:14140494-14140516 TAATACAAAATACATTTAGAGGG + Intergenic
902312240 1:15590027-15590049 AAATCTAAAAAAAAGTTAGCTGG + Intronic
902355459 1:15895839-15895861 AAATATAAAAAAAAATTAGCTGG - Intronic
902582772 1:17419195-17419217 AAATACAAAAAAAAGTTAGCTGG + Intronic
903472363 1:23596103-23596125 AAAAAAAAAAAAAAGTTAGGTGG + Intronic
903557603 1:24204943-24204965 AAAAATAAAAAAAAGTTAGCTGG - Intergenic
903591120 1:24456599-24456621 AAAAATAAAATAAAATTAGCTGG + Intronic
903746036 1:25587311-25587333 AAATAAAAAATAAAATTAGCAGG - Intergenic
904309375 1:29617920-29617942 ATTTATAAAGTACAGTTTGGCGG + Intergenic
904642789 1:31942971-31942993 AAATATAAAAAAAAATTAGTTGG + Intronic
904875696 1:33652914-33652936 AAATACAAAAAAAAATTAGGTGG - Intronic
905148026 1:35903372-35903394 AGATACAACATACAGTTAGTTGG + Intronic
905341068 1:37277933-37277955 AAATAAAAAATAAATTTAGTTGG - Intergenic
905444228 1:38014795-38014817 AAAAATAAAATAAAATTAGCTGG - Intronic
905708599 1:40081564-40081586 AAATAGAAAATAAAATTAAGAGG + Intronic
905712555 1:40118823-40118845 ATATATAATATAATGTTAGGTGG - Intergenic
905762018 1:40566785-40566807 AAAAATACAAAACAGTTAGCTGG - Intergenic
906547754 1:46633624-46633646 AAATATAAAGAACAGCTACGTGG + Exonic
907175357 1:52516197-52516219 ATATATAAAATATAGGTAAGAGG + Intronic
907231499 1:53003679-53003701 AAAAATAAAATAAAATTAGCTGG - Intronic
907646573 1:56250538-56250560 AAATTTCAAAATCAGTTAGGAGG - Intergenic
907717961 1:56945248-56945270 AAATAGAAAATATAATTTGGAGG + Intronic
908462759 1:64361956-64361978 AAAAATAAAATAAAATTAGCTGG + Intergenic
908674762 1:66591417-66591439 AAAGAAAAAATACAGTAAGCAGG - Intronic
908895264 1:68891583-68891605 AAATAGAAAATATAGATTGGGGG - Intergenic
908990140 1:70076777-70076799 AATTATAAAGAACAGTTAGAAGG + Intronic
909536647 1:76744324-76744346 AACAATAAAATACAGTGGGGGGG - Intergenic
909920808 1:81378397-81378419 AAATATAAAAAATAATTAGCTGG + Intronic
910235468 1:85031277-85031299 AAAAAAAAAATACAGTGAGATGG + Intronic
910523069 1:88145535-88145557 AAAAAAAAAAAACATTTAGGAGG - Intergenic
910932201 1:92453785-92453807 AAATACAAAAAAAAATTAGGTGG - Intergenic
910946966 1:92603892-92603914 AAATACAAAATAAAATTAGTTGG - Intronic
911048945 1:93653418-93653440 AAATATACAATACAGTGAACTGG - Intronic
911241507 1:95472010-95472032 AAATATAAAATAAAGATCTGAGG - Intergenic
911344380 1:96678642-96678664 AAATACAAAAAAAAGTTAGCCGG - Intergenic
911381097 1:97116102-97116124 AAAGAAGAAATACATTTAGGAGG + Intronic
911658645 1:100475197-100475219 AAATGTAAAATTCAGTGAGTGGG - Intronic
911783814 1:101919053-101919075 AAAATTAAAGTACAGTTAGGTGG - Intronic
911889092 1:103344445-103344467 AAATAAAAAAAACAGTTGGCTGG - Intergenic
911977309 1:104515773-104515795 AAATACAAAAGACAATTAGCCGG + Intergenic
911998096 1:104793631-104793653 AAAAATAAAATAAAATTAGTAGG + Intergenic
912029783 1:105226582-105226604 AAATATATCATTCAGTAAGGTGG - Intergenic
912194920 1:107386329-107386351 AAATACAAAAAAAAGTTAGCTGG - Intronic
912216307 1:107617048-107617070 AAATATAAAACACAGATAAAAGG - Intronic
912346924 1:108972340-108972362 AAATATAAATGTCAGTGAGGAGG - Intronic
912869960 1:113294677-113294699 AAATACAAAAATCAGCTAGGCGG + Intergenic
913098121 1:115539001-115539023 CAATAAAAAATCAAGTTAGGAGG - Intergenic
913513355 1:119582161-119582183 AAAAATACAAAAAAGTTAGGGGG + Intergenic
914217045 1:145640703-145640725 AAAAAAAAAATACTGTTAAGAGG + Intronic
914238020 1:145830312-145830334 AAAAAAAAAACCCAGTTAGGAGG + Intronic
914469614 1:147963384-147963406 AAAAAAAAAATACTGTTAAGAGG + Intronic
915251497 1:154592455-154592477 AAGTATAAAGATCAGTTAGGAGG + Intronic
915262759 1:154690200-154690222 AAATACAAAAAAAAGTTAGCCGG - Intergenic
915356913 1:155260902-155260924 AAAAAAAAAACACAGTTAAGTGG - Intronic
915426413 1:155830746-155830768 AAAAATAAAATAAAATTAGCTGG - Intronic
915471377 1:156127499-156127521 AAAAAAAAAAAACAGTAAGGGGG - Intronic
915775695 1:158483435-158483457 GGATATAAAAGACATTTAGGAGG - Intergenic
916021657 1:160797800-160797822 AAGTGTAAAATATAGTTAGTAGG + Intronic
916397637 1:164409186-164409208 AAATATAAAAAAAAATTAGCCGG + Intergenic
916629058 1:166592256-166592278 ATATATTAAATACAGTAAAGCGG + Intergenic
917081959 1:171264735-171264757 AAAAATAAAATAAAATTAGCAGG + Intronic
917779546 1:178378048-178378070 AAATAGAAAATACAGTAAGATGG + Intronic
918323968 1:183392057-183392079 AAATAGTAAATAAAGTCAGGAGG - Intronic
918458164 1:184747791-184747813 AACTATAGAATACACTTAGTAGG - Intronic
918521433 1:185419250-185419272 AAATATAAAATAAAGTAGGCTGG - Intergenic
918758708 1:188373105-188373127 AAAGTTAAAATAGAGTCAGGTGG - Intergenic
918815577 1:189176631-189176653 AAGTAGAAAATACACTTATGAGG - Intergenic
919227357 1:194723118-194723140 AAATATAAAAAACATATAGAAGG - Intergenic
919385512 1:196918242-196918264 AAAAATAACATACAGTTAAAAGG + Exonic
919627720 1:199928284-199928306 AAATATAAAAAAAAATTAGCCGG + Intergenic
919962607 1:202486643-202486665 AAAAATAAAAAAAAGTTAGCAGG + Intronic
920320696 1:205120133-205120155 AAATAGAAAAGACATTGAGGAGG - Intronic
920526338 1:206669374-206669396 AAATATAAAAATCAATTAGCTGG - Intronic
920634638 1:207688111-207688133 AAAAATAAAATAAAATTAGCTGG + Intronic
920641235 1:207753328-207753350 AAATACAAAATAAATTTAGTGGG - Intronic
920843143 1:209571639-209571661 AAATATAAGAAATATTTAGGAGG + Intergenic
921071935 1:211667646-211667668 AAAAACACAATTCAGTTAGGTGG + Intronic
921657410 1:217757243-217757265 AAATAAAAAAGACAGATAGTTGG + Intronic
921863759 1:220066974-220066996 AAATATATAATGCATTTAGTGGG + Intronic
921999840 1:221465493-221465515 AAAAATAAAATAAAGTAAGCAGG - Intergenic
922358481 1:224798824-224798846 AAATATAAAAATCAGTTATAGGG - Intergenic
922672828 1:227526055-227526077 CACTATAAAGTACAGTTTGGAGG - Intergenic
923104886 1:230846801-230846823 AAATATAAAAATCAGCCAGGCGG + Intronic
923121343 1:230994701-230994723 AAATACAAAAAACAATTAGCCGG - Intronic
923485775 1:234429681-234429703 AAATAAAAAATAAAGTTACTAGG + Intronic
923850354 1:237787428-237787450 AAATGTAAAAAAAAGTTAGCTGG + Intronic
923876367 1:238053233-238053255 AAATTTAAAACACAGTTATTTGG + Intergenic
924092983 1:240521407-240521429 AAATACAAAAAACAATTAGCCGG + Intronic
924185064 1:241479759-241479781 AAATTTAAAAAACAGTGAGATGG + Intergenic
924484855 1:244472118-244472140 AAAAATAAAATAAAATTAGCTGG - Intronic
924668457 1:246098047-246098069 AAATATAAAAATCAGTTTAGTGG - Intronic
924828144 1:247563452-247563474 AAATATTAAATACAATTAAAAGG - Intronic
1063133017 10:3194847-3194869 AAATAGAAAAAACAGTAAGAGGG - Intergenic
1063456110 10:6183847-6183869 AAATATAAAAAAAAATTAGCCGG - Intronic
1064670389 10:17707647-17707669 AATGACAAAATAAAGTTAGGAGG + Intronic
1064908484 10:20373271-20373293 AAATACAAAAAAAAGTTAGCCGG - Intergenic
1064969387 10:21048845-21048867 AAATAAAAAATAAAATTAGCCGG + Intronic
1065514746 10:26513892-26513914 AAAAATACAAAACAGTTAGCTGG - Intronic
1067392821 10:45880731-45880753 AATTAAAAAAAAAAGTTAGGTGG + Intergenic
1067557148 10:47280628-47280650 AAATAAAAAAAAAAGTTAGCGGG + Intergenic
1067861147 10:49849854-49849876 AATTAAAAAAAAAAGTTAGGTGG + Intronic
1068223870 10:54081286-54081308 AAATACTATATACAGTTGGGAGG - Intronic
1068694925 10:59957415-59957437 AAATATAAAAAAAAGTTAGCCGG - Exonic
1068717262 10:60202104-60202126 AAATAAAAAATAAAGTATGGGGG - Intronic
1068882110 10:62061412-62061434 AAACATAAAATAGAGTGATGAGG + Intronic
1068971244 10:62960767-62960789 AAATATAAAAATTAGTTGGGCGG + Intergenic
1069432387 10:68349356-68349378 AAAAATAAAATAAAATTAGCAGG + Intronic
1069546420 10:69332538-69332560 AACTATAAAAAAAAGTTAGCTGG - Intronic
1069648995 10:70029048-70029070 AAAGATAAAATACATTTGGGAGG - Intergenic
1069661890 10:70128518-70128540 AAATACAAAAAACAATTAGCCGG - Intronic
1070212931 10:74345681-74345703 ATACATAAAAGACAGTTATGTGG - Intronic
1070606693 10:77903454-77903476 AAATTAAAAATACAATTAGCCGG + Intronic
1070626994 10:78058284-78058306 AAAAATAAAAAACAATTAGCTGG - Intergenic
1071000498 10:80825662-80825684 AAATACAAAAAACAATTAGCCGG + Intergenic
1071087618 10:81881112-81881134 AACTATAAAATACTGGCAGGTGG - Intronic
1071212108 10:83355408-83355430 AAAAATAAAATAAAATTAGCCGG - Intergenic
1071537118 10:86442879-86442901 AAATACAAAAAAAAGTTAGCCGG + Intronic
1072141105 10:92590034-92590056 AAATATAAAAAAAAATTAGCCGG + Intergenic
1072291163 10:93966207-93966229 AAACACAAACTACAGTGAGGTGG + Intergenic
1072345242 10:94498613-94498635 AAATATACAAAACAATTAGCCGG - Intronic
1072590340 10:96823250-96823272 AAAAATAAAAAACAATTAGCAGG - Intergenic
1072958371 10:99906965-99906987 TAATTTAAAATACATTTATGTGG - Intronic
1073040775 10:100603522-100603544 AAATACAAAAAAAAGTTAGCAGG + Intergenic
1073180810 10:101581965-101581987 AAAAATACAAAAAAGTTAGGCGG - Intronic
1073532798 10:104247679-104247701 AAATGTACGATACAGTTATGTGG + Intronic
1074059488 10:109951805-109951827 AAATACAAAATAAAATTAGCCGG + Intronic
1074625027 10:115174015-115174037 AAAAATAAAATAAAGTTAAGGGG - Intronic
1074645517 10:115447351-115447373 CAAAACAAAATACAGTTTGGTGG - Intronic
1074690938 10:116003510-116003532 AACAATAAAGAACAGTTAGGGGG - Intergenic
1074911629 10:117914955-117914977 AAAAAAAAAAAAAAGTTAGGGGG + Intergenic
1075192759 10:120326079-120326101 AAATACAAAAAAAAGTTAGCTGG - Intergenic
1075509646 10:123060910-123060932 AAATATAAAATACAAATTGTTGG + Intergenic
1075617432 10:123901660-123901682 AAATTTAAAATACAGTCAAGTGG + Intronic
1075931964 10:126305606-126305628 AAAGATAAAATACACATAAGTGG - Intronic
1076018440 10:127049083-127049105 AATTATAAAATAGATTCAGGAGG - Intronic
1076161731 10:128249057-128249079 AAATACAAAATAGAGTTTTGTGG - Intergenic
1077274737 11:1699180-1699202 AAATATAAAAAAAAATTAGCCGG - Intergenic
1077625834 11:3770327-3770349 AAAAATAAAATAAAATTAGTCGG + Intronic
1078154898 11:8790934-8790956 CCTTTTAAAATACAGTTAGGTGG + Intronic
1078389516 11:10924771-10924793 AAATACAAAATACAAATAGCCGG - Intergenic
1078400112 11:11018931-11018953 AAAAATAAAATACACTTTGGGGG - Intergenic
1078494594 11:11803136-11803158 AAATACAAAAATTAGTTAGGTGG - Intergenic
1078962836 11:16299479-16299501 AAATCTGAAATACAGTAAAGTGG + Intronic
1079818120 11:25088862-25088884 AAATATAAGGTACAGCAAGGAGG - Intergenic
1080033905 11:27691170-27691192 TAATTAAAAATACAGTTTGGGGG + Intronic
1080062052 11:27967204-27967226 AGATATAAAAAAAAGTTTGGGGG + Intergenic
1080272970 11:30470320-30470342 ATATATAAATTATAGTTAGATGG + Intronic
1080509036 11:32948465-32948487 AAAACAAAAAAACAGTTAGGTGG + Intronic
1080687295 11:34525860-34525882 GAATAAAAAATAGAGTCAGGGGG - Intergenic
1080950177 11:37022702-37022724 AAACATAAAATAAATCTAGGAGG - Intergenic
1080968011 11:37236381-37236403 AGATATAAAATAAAATTAGCTGG - Intergenic
1081602001 11:44501705-44501727 AAATATAAAAAAAAATTAGCTGG + Intergenic
1081852014 11:46280347-46280369 AAATATAAAAAAAAATTAGCCGG - Intronic
1082090428 11:48084757-48084779 AAATTTAAAATACAGCCAAGTGG - Intronic
1083754544 11:64783924-64783946 AAATAAAAAATACATTGAGGTGG + Intergenic
1084081822 11:66832257-66832279 AAATAGAAAAAACAATTAGTCGG - Intronic
1085481794 11:76829243-76829265 AAAAATGAAATACATTTAGGGGG - Intergenic
1085899331 11:80679224-80679246 AAAGTTAAAATAGAGTTAGCAGG - Intergenic
1086527705 11:87748000-87748022 AAGAATACAATACATTTAGGCGG - Intergenic
1086537410 11:87864788-87864810 AAGTATAAAATATTGTTAGATGG + Intergenic
1086750201 11:90483816-90483838 AAATATAAAATACAATCATCTGG - Intergenic
1086802847 11:91198994-91199016 AAATATTAAATAGAGATATGAGG - Intergenic
1086838396 11:91654028-91654050 AAATATACAAAACAATTAGCCGG - Intergenic
1086972398 11:93097727-93097749 AATTATAAAATACATTTTGGGGG - Intergenic
1086992767 11:93323570-93323592 AAATTTAAAAAATATTTAGGAGG + Intergenic
1087425465 11:97980567-97980589 AAATACAAATTACAGGTAGTTGG + Intergenic
1087816917 11:102668705-102668727 AATTAAAAAATATATTTAGGGGG + Intergenic
1087850081 11:103018051-103018073 AAATAAAAAATAAAGTTAGCTGG - Intergenic
1088401496 11:109425440-109425462 AACAATAATATACAGTTTGGAGG - Exonic
1088500085 11:110474346-110474368 AAATACAAAACACAGTTAACGGG - Intergenic
1088781901 11:113143164-113143186 AAATACATAATACATTTCGGAGG - Intronic
1089251955 11:117170650-117170672 AAAAATAAAATAAAGTAAGTTGG - Exonic
1089575906 11:119443109-119443131 CACTATAAAAAACAGTTTGGAGG - Intergenic
1089875002 11:121712692-121712714 AAATATCAAAAACAGTTAAGTGG - Intergenic
1089876360 11:121725413-121725435 AGATATAAAATACACTTATGAGG - Intergenic
1089980296 11:122766579-122766601 AAATAAAAAATAAAATTAGCCGG + Intronic
1090053042 11:123397244-123397266 AAATACAAAAAAAAGTTAGCTGG + Intergenic
1090889271 11:130908522-130908544 AAATAAAAATAACAGTTAAGGGG + Intronic
1091566620 12:1653394-1653416 AAATTTAAAAAAAAGTTGGGTGG + Intergenic
1091984281 12:4895495-4895517 AAACATAAAATAAATTTTGGAGG + Intergenic
1092267101 12:6990013-6990035 AAATAAAAAAAATAGTTGGGTGG + Intronic
1092694755 12:11158705-11158727 AAATATAAAATTAACTTATGAGG + Intronic
1092851141 12:12628039-12628061 AAAAATAAAAAACAATTAGCTGG - Intronic
1093386192 12:18558007-18558029 AATTCTAAAATATATTTAGGAGG + Intronic
1093525901 12:20103015-20103037 AAATACAAAAAACAATTAGCCGG + Intergenic
1093650079 12:21633313-21633335 TAATATAAAAAGCAATTAGGAGG + Intergenic
1093720252 12:22433689-22433711 AAATTAAAAATATATTTAGGAGG - Intronic
1093820961 12:23616965-23616987 AAAAATAAAATAAAATTAGCTGG + Intronic
1093871836 12:24302087-24302109 AAATGTAAAATACAACTGGGTGG + Intergenic
1093933805 12:24980238-24980260 AAATAGAAAATCCAGTCAAGTGG - Intergenic
1094196174 12:27752084-27752106 AAAAATAAAATAAAATTAGCTGG + Intronic
1094365029 12:29671132-29671154 AAATACAAAATAAAATTAGCTGG + Intronic
1094590770 12:31817799-31817821 AAATATAAAAAAAAATTAGCTGG - Intergenic
1095169521 12:39018401-39018423 AAATATTCAATACAGAAAGGAGG + Intergenic
1095311833 12:40707408-40707430 AAATACAAAAAACAATTAGCCGG - Intronic
1095702239 12:45202344-45202366 AAATACAAAAAAAAGTTAGCTGG - Intergenic
1095774751 12:45999816-45999838 AAATACAAAAACCAGTCAGGCGG - Intergenic
1096016953 12:48285389-48285411 AAATACAAAAAAAAGTTAGCTGG - Intergenic
1096205488 12:49718218-49718240 AAATTAAAAATAAAGTTAGCCGG + Intronic
1096363293 12:51006897-51006919 AAAAATAAAATAAAATTAGTTGG - Intronic
1096396024 12:51267486-51267508 AAAAAAAAAAAAGAGTTAGGGGG - Intronic
1097070837 12:56353695-56353717 AAATATAATATACTGTTGGCCGG + Intronic
1097256851 12:57683313-57683335 AAATAAAAAATAAAAATAGGCGG - Intergenic
1097379136 12:58874422-58874444 AAACATATCATACAGGTAGGTGG - Exonic
1097539810 12:60926633-60926655 AAATATAACATACAGTTCCTTGG + Intergenic
1098920939 12:76301690-76301712 AAAAAAAAAATTCAGATAGGAGG - Intergenic
1099135122 12:78887936-78887958 AGAAATAAAATTCAGTTAGTTGG - Intronic
1099220899 12:79912530-79912552 AAAAATAAAAAACAGTTAGCTGG + Intronic
1099447286 12:82767423-82767445 AAATAAAAAATAAAATTAGCTGG + Intronic
1099516718 12:83605891-83605913 AAATACAAAAAAAAGTTAGCTGG + Intergenic
1099570164 12:84307008-84307030 AAAAATAAAGTACAGTTAGAAGG + Intergenic
1099756298 12:86854980-86855002 AATTAGAAAATACATTTAAGTGG + Intergenic
1100018267 12:90038749-90038771 AAAAATAAAATCCTGTTAGTTGG - Intergenic
1100180849 12:92084720-92084742 AAAAATAAAATAAAATTAGCTGG - Intronic
1100472862 12:94909137-94909159 AAATATATAAGACAGTTTAGGGG - Intronic
1100622961 12:96298123-96298145 AAATACAAAAAAAAGTTAGCCGG + Intronic
1101056038 12:100914974-100914996 AAATATAAAATAAAATTAGCTGG - Intronic
1101355609 12:103974809-103974831 AAATATAAAAAAAAATTAGCTGG + Intronic
1101701238 12:107176274-107176296 AAAAATAAAAAAAAATTAGGAGG + Intergenic
1101857554 12:108456555-108456577 AAAAAAAAAAAAAAGTTAGGGGG + Intergenic
1101895688 12:108754739-108754761 AAAAATAAAAAACAATTAGTTGG + Intergenic
1102079555 12:110086850-110086872 AAATAGAAAATATAGCCAGGTGG + Intergenic
1102119892 12:110431741-110431763 AAAAATACAAAAAAGTTAGGGGG + Intergenic
1102235240 12:111290421-111290443 AAAAATAAAATAAAATTAGCTGG - Intronic
1102662749 12:114544131-114544153 AAAAATAAAATAAAATTAGCTGG + Intergenic
1102668350 12:114596136-114596158 AAATATAAAAAACAGCCTGGTGG + Intergenic
1102718132 12:114992134-114992156 AAAAATAAAATAAAATTAGCTGG + Intergenic
1103013812 12:117478594-117478616 AAAAATAAAATAAAATTAGCAGG - Intronic
1103030652 12:117609441-117609463 AAATAAAAAATACAGGTGGCAGG - Intronic
1103121094 12:118380000-118380022 AAACATTACATACAGTTAGTAGG - Intronic
1103245440 12:119452982-119453004 AAATACAAAATAAAATTAGCTGG - Intronic
1103448906 12:121014168-121014190 AAATATAAAAAAAAATTAGCTGG + Intronic
1103696337 12:122818624-122818646 AAAAATAAAATAAAATTAGCTGG + Intronic
1104000968 12:124859832-124859854 AAATATAGAATATTGTTTGGTGG + Intronic
1105289718 13:19044750-19044772 AAATTTAAAATAGAGTAAGAGGG + Intergenic
1105390329 13:19971119-19971141 AAATATTACATACAGGTAAGGGG + Intronic
1105513411 13:21070528-21070550 AAATATAAAAAAAAATTAGCTGG - Intergenic
1105516944 13:21099322-21099344 ATATATAAAAAACATTTTGGGGG - Intergenic
1105559911 13:21480654-21480676 AAATACAAAAAACATTTAGCCGG + Intergenic
1105838923 13:24236431-24236453 AAATATAAAAAAAAATTAGCTGG + Intronic
1106130463 13:26935215-26935237 AAAAATAAAATAAAATTAGCTGG + Intergenic
1106507870 13:30387219-30387241 AAATACAAAAAAAAATTAGGCGG + Intergenic
1106840206 13:33678720-33678742 AAAAATAAAAAAAAATTAGGTGG + Intergenic
1106927465 13:34628483-34628505 AAATACAAAACAAAGTTAGCAGG + Intergenic
1107012916 13:35685546-35685568 AAAAAAAAAAGAGAGTTAGGTGG - Intergenic
1107536840 13:41343689-41343711 AAAAATAAAATAAAATTAGCCGG - Intronic
1107537454 13:41349805-41349827 AAATACAAAAAAAAGTTAGCTGG + Intronic
1107581505 13:41793652-41793674 AAATACAAAAAACAATTAGCTGG + Intronic
1107649744 13:42533236-42533258 AAATATAAAAGAAAATTATGAGG + Intergenic
1108067031 13:46588760-46588782 AAATATACAAAAAAGTTAGCTGG - Intronic
1108189534 13:47923434-47923456 AAAAATAAAATAAAATTAGCTGG + Intergenic
1108608138 13:52060857-52060879 AAATAAAAAATAAAGTTTGAGGG - Intronic
1108754191 13:53480091-53480113 AAAGATGAAATAAAGTTAGCTGG - Intergenic
1108780421 13:53824212-53824234 AATTATAGAAGACATTTAGGAGG - Intergenic
1108809047 13:54198141-54198163 AGATATAAAATACATTTTAGAGG - Intergenic
1108964478 13:56279716-56279738 AGAAAAAAAATACAGTTAGAGGG - Intergenic
1109419128 13:62087158-62087180 AACTATATAATAGAGATAGGAGG - Intergenic
1109532288 13:63665312-63665334 AAATTAAAATTACAGTTAAGGGG - Intergenic
1109805355 13:67433156-67433178 ATCTATAAAATACTGTTAAGAGG - Intergenic
1109984740 13:69965081-69965103 AAAAATAAAATACAATTATTTGG + Intronic
1110167244 13:72458149-72458171 AAATATAAGTTACATTAAGGAGG + Intergenic
1110210143 13:72962435-72962457 AAAAATAAAATAAAATTAGCCGG + Intronic
1110831636 13:80038371-80038393 AAATATAAAGTCCAGTTTAGGGG + Intergenic
1110969585 13:81744535-81744557 GATTATGAAATAAAGTTAGGAGG + Intergenic
1111010349 13:82304905-82304927 AAATAAAAAATAAAATTAGCCGG + Intergenic
1111106206 13:83648785-83648807 AAATACAAAATAAAATTAGCTGG - Intergenic
1111150949 13:84253103-84253125 AAAAATACAATAAAGTTAGCTGG - Intergenic
1111181706 13:84677161-84677183 AAATATAAAAGACAATGAAGTGG - Intergenic
1111272954 13:85911702-85911724 AAATATTAAAGACATTAAGGGGG - Intergenic
1111308987 13:86456533-86456555 AAATAAAATAAACAATTAGGAGG + Intergenic
1112264996 13:97915460-97915482 AAAAATAAAATGCAGTAAGGAGG + Intergenic
1112309599 13:98306674-98306696 AAATAAAAAAAAAAGTTAGCCGG - Intronic
1112548996 13:100402301-100402323 AAATGTAAAAAACACTTAGCTGG + Intronic
1112916826 13:104561611-104561633 AAATACAAAAAACAATTAGCTGG - Intergenic
1113139869 13:107135317-107135339 AAATTTCAAATACACTCAGGCGG - Intergenic
1113419741 13:110161725-110161747 AAAATTAAAACACAGTTTGGTGG + Intronic
1114038424 14:18652395-18652417 AAATTTAAAATAGAGTAAGAGGG + Intergenic
1114120194 14:19662649-19662671 AAATTTAAAATAGAGTAAGAGGG - Intergenic
1114142003 14:19922822-19922844 AAAAATAAAATAGAGTGATGGGG - Intergenic
1114446629 14:22793652-22793674 AAATAAAAAATAAAATTAGCTGG + Intronic
1114738525 14:25069043-25069065 AAATAAAAAAAAAACTTAGGTGG - Intergenic
1114802019 14:25786714-25786736 AATTAAAAAATATATTTAGGAGG + Intergenic
1115182835 14:30649343-30649365 AACTAAAAAATATATTTAGGGGG - Intronic
1115213020 14:30987205-30987227 AAATATAAAATACAATTTAAGGG + Intronic
1115239797 14:31243023-31243045 AAATACAAAATAAAATTAGCCGG - Intergenic
1115363431 14:32529874-32529896 AAATATAAAATACATGTATTAGG + Intronic
1115474219 14:33798843-33798865 AACTAAAATATACAGTGAGGTGG + Intronic
1115672105 14:35625030-35625052 AAATACAAAAAAAAGTTAGCCGG + Intronic
1115996608 14:39201886-39201908 AAAAATAAAATAAAATTAGCTGG - Intergenic
1116101073 14:40437121-40437143 AAGTATAAAAGCCAGTTTGGAGG + Intergenic
1116460669 14:45169559-45169581 AAAAATAAAATAAAATTAGCTGG - Intronic
1116506282 14:45686084-45686106 AAAAATAAAATAAAATAAGGAGG - Intergenic
1116572547 14:46535547-46535569 AAATATAAAAATCAGGTAGCTGG - Intergenic
1116617089 14:47153714-47153736 AAAAAAAAAAAACAGTTGGGCGG + Intronic
1116878422 14:50138316-50138338 AAATATAAAAAAAAATTAGCTGG - Intronic
1116923405 14:50606236-50606258 GAATAAACAATACAGTTAAGAGG - Intronic
1117749968 14:58911127-58911149 AAATAAAAAATATTGTTATGGGG - Intergenic
1118026708 14:61775839-61775861 AGATATAAGATACACTTATGGGG - Intronic
1118279290 14:64413989-64414011 AAAAATAAAATAAAATTAGCTGG - Intronic
1118396019 14:65337325-65337347 AAATAAAAAATAAAATTAGCAGG + Intergenic
1118420596 14:65598009-65598031 AAATAAAAAATACAATTAGCTGG + Intronic
1118442257 14:65822533-65822555 AAATAGAGAACACAGTTAGGAGG - Intergenic
1118614176 14:67563893-67563915 AAAAAAAAAAAACAGTTAGCCGG - Intronic
1118634184 14:67732736-67732758 AAATACAAAAAACAATTAGCCGG - Intronic
1118739837 14:68731378-68731400 AAAAATAAAACACAGCGAGGGGG - Intergenic
1119053618 14:71395499-71395521 AAAAATAAAAAACAATTAGCTGG + Intronic
1119294914 14:73525191-73525213 AAAAATAAAAAACAGATAGCTGG - Intronic
1119346562 14:73929675-73929697 AAAAATAAAATAAAATTAGCTGG + Intronic
1119366346 14:74095139-74095161 AAAAAAAAAAAACAGTTAGTTGG - Intronic
1119591731 14:75895095-75895117 AAATAGAAAATACATTTTAGGGG + Intronic
1119824539 14:77646294-77646316 AAAAATAAAATAAAATTAGCTGG + Intergenic
1119933849 14:78572723-78572745 AAATGTAAAATATAGTTGGAAGG - Intronic
1120313165 14:82857312-82857334 AAATACAAAAAAAATTTAGGCGG + Intergenic
1120529251 14:85612150-85612172 AAAAAAAAAACACAGTTAAGTGG + Intronic
1121211130 14:92208552-92208574 AAAAAAAAAAAAAAGTTAGGGGG - Intergenic
1121385224 14:93515127-93515149 AAATTTAAAACATAATTAGGAGG - Intronic
1121572617 14:94958626-94958648 AAATATAGAATATAGAAAGGGGG - Intergenic
1121853029 14:97240183-97240205 AAATATAAAAAAAAGTGAGCCGG + Intergenic
1121903551 14:97718176-97718198 AAATATACAATAAAGATAAGTGG + Intergenic
1122361147 14:101165503-101165525 AAATTTAAAAATCATTTAGGAGG - Intergenic
1122426014 14:101605718-101605740 AAAAATAAACTCCAGTTAGTGGG - Intergenic
1122534587 14:102453316-102453338 AAATACAAAAAAAAATTAGGTGG + Intronic
1123045121 14:105508490-105508512 AAATAAAAAAAAAAGTTATGTGG - Intergenic
1123052606 14:105553310-105553332 AAAAAAAAAATACAATTAGCTGG - Intergenic
1123680726 15:22761545-22761567 AAATATAAAATACAGTGGCCGGG + Intergenic
1123860152 15:24457833-24457855 AAAAATAAAAAACAATTAGCCGG - Intergenic
1124199436 15:27665637-27665659 AAATATAAAACACATTTATGTGG - Intergenic
1124200630 15:27675924-27675946 AAATAATAAATACAGCTGGGAGG + Intergenic
1124332935 15:28836003-28836025 AAATATAAAATACAGTGGCCGGG + Intergenic
1124612864 15:31220654-31220676 AAATATAACAACCAGTTAGATGG - Intergenic
1124917651 15:33992226-33992248 AAAAATACAAAACAGTTAGCTGG + Intronic
1125046729 15:35250002-35250024 AAATATAAAAAAAAATTAGCCGG + Intronic
1125421520 15:39509570-39509592 AAATGTAAAATATAGTCACGTGG - Intergenic
1125670525 15:41469122-41469144 AAATACAAAACAAAATTAGGTGG - Intronic
1125772556 15:42179646-42179668 AAATAAAAAAGAAAGGTAGGGGG + Intronic
1125822344 15:42642958-42642980 AAAAATAAAAAACAATTAGCTGG - Intronic
1125892127 15:43274639-43274661 AAAAATAAAATAAAATTAGTTGG + Intergenic
1126014742 15:44339794-44339816 AAATAAAAAATAAAATTAGCTGG - Intronic
1126292813 15:47100308-47100330 AAAAATAAAAAACAATTAGATGG - Intergenic
1126373258 15:47969032-47969054 AAACAGAAAAAACAGTTATGTGG + Intergenic
1126609859 15:50518380-50518402 AAATATAAAAAAAAATTAGCCGG - Intronic
1127085648 15:55422181-55422203 AAACATAAAATAGAGTTAGGAGG + Intronic
1127240958 15:57113791-57113813 AAAAAAAAAATTCAGCTAGGCGG + Intronic
1127690427 15:61390531-61390553 AAAAATGAAATACATTTAAGGGG + Intergenic
1127971259 15:63963466-63963488 AAAAACAAAAAACAGTTAAGAGG - Intronic
1128459759 15:67857962-67857984 AAATATAAAAATTAGCTAGGGGG + Intergenic
1129044653 15:72723709-72723731 ATACATAAAATACATTTAGTGGG + Intronic
1129526764 15:76222826-76222848 AAAAAAAAAATTCAGTTTGGGGG - Intronic
1129532648 15:76281160-76281182 AAATATAAAAATTAGCTAGGTGG - Intronic
1130328697 15:82902962-82902984 AAATATAACAGACTCTTAGGTGG - Intronic
1130528078 15:84724251-84724273 ACATATAAAATATAGGTATGGGG - Intergenic
1131109195 15:89754108-89754130 ACATATAAAATACAGTAATGAGG + Intergenic
1131681837 15:94731694-94731716 AAATAAAAATTACAGTTTGTTGG + Intergenic
1131819622 15:96258902-96258924 AAAAATAAAAAATAGTTAGCTGG + Intergenic
1132418054 15:101638454-101638476 AAAAATACAAAACAATTAGGTGG - Intronic
1132535244 16:475837-475859 AAATAAAAAATAAAGTAAGCCGG - Intronic
1133266143 16:4585303-4585325 AAAAAAAAAATCCAGGTAGGTGG + Intronic
1133333529 16:4991402-4991424 TAAAATAAAATAAAATTAGGTGG + Intronic
1133483314 16:6193420-6193442 ATATATAAAATTCAGTGAGAAGG + Intronic
1134160503 16:11884600-11884622 AAATACAAAAAACAATTAGCTGG + Intronic
1134358076 16:13503006-13503028 AATTAAAAAACACAGTTTGGTGG + Intergenic
1134824161 16:17271138-17271160 ACAAACAAAAAACAGTTAGGAGG - Intronic
1135103918 16:19630845-19630867 AAATAAAAAAAAAAATTAGGTGG + Intronic
1135508078 16:23056570-23056592 AAATTAAGAATACAATTAGGTGG + Intergenic
1135779783 16:25290324-25290346 AAATAAAAAATAAAATTAGTCGG - Intergenic
1135921187 16:26650294-26650316 AAAAATAAAATAAAATTAAGCGG + Intergenic
1136890624 16:33969593-33969615 AAATACAAAAAACAATTAGCCGG - Intergenic
1137307083 16:47212519-47212541 ACATTTAAAATACAGTTAACTGG - Intronic
1137378311 16:47974108-47974130 AAATACAAAATAAAATTAGCCGG + Intergenic
1138135779 16:54521187-54521209 ATACATAAAATACATTTATGTGG + Intergenic
1138866204 16:60823383-60823405 AAAAATAAAAACCACTTAGGAGG - Intergenic
1138914180 16:61442586-61442608 AAAAAAAAAAAACATTTAGGTGG + Intergenic
1139071379 16:63387837-63387859 AAATATAAAAAAAAATTAGCTGG + Intergenic
1139443750 16:66983657-66983679 AAATAGAAAAAACAATTAGCTGG - Intergenic
1140215829 16:73007434-73007456 AAAAACAAAAAACAGTTATGAGG - Intronic
1140329290 16:74037686-74037708 AAATAAAAAAGAAAGTTAGCTGG - Intergenic
1140329792 16:74043575-74043597 AAATTTAAAATTCAGTAAAGGGG + Intergenic
1140503687 16:75456427-75456449 AAATATAAAAATTAGCTAGGTGG + Intronic
1140672819 16:77295574-77295596 CAACATAAAATACAATGAGGAGG + Intronic
1141018514 16:80472460-80472482 AAAAATAAAATAAAATTAGCTGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141442410 16:84037968-84037990 AAATACAAAAAACAATTAGCTGG - Intronic
1141530211 16:84641097-84641119 AAAAATAAAATAAAATTAGCTGG - Intergenic
1141645992 16:85368009-85368031 AAATACAAAACACAATTAGCCGG - Intergenic
1142139415 16:88466096-88466118 AAATATAAAATCCAGGAAGGGGG - Intronic
1142176714 16:88648610-88648632 AAAAAAAAAAAACAGTAAGGGGG - Intronic
1203082407 16_KI270728v1_random:1154015-1154037 AAATACAAAAAACAATTAGCCGG + Intergenic
1143051060 17:4126234-4126256 AAAAAAAAAAAAGAGTTAGGAGG + Intronic
1143076618 17:4349541-4349563 AAAAATAAAATACATTTAATTGG + Intronic
1143397762 17:6616120-6616142 AAATATAAAATAAAACTAAGAGG + Intronic
1143464254 17:7125305-7125327 AAATACAAAATAAAATTAGCCGG + Intergenic
1143607352 17:7996375-7996397 AAATATAAAATATTTTAAGGAGG + Intergenic
1144093285 17:11876883-11876905 AAATACAAAAAAAAGTTAGCCGG - Intronic
1144535907 17:16091747-16091769 AAATATAATAATCAGTTGGGAGG + Intronic
1144537684 17:16107052-16107074 AAATACAAAAAAAAGTTAGCCGG - Intronic
1144567871 17:16375108-16375130 AAAAATACAAAACAGTTAGCTGG - Intergenic
1144932625 17:18872109-18872131 AAAAATACAAAACAGTTAGCTGG + Intronic
1144953731 17:19008236-19008258 AAAACTAAAATAGAGTTAAGAGG - Intronic
1145228459 17:21151634-21151656 CAAAATAAAAGACAGATAGGTGG + Intronic
1145359722 17:22202283-22202305 AAAAATACAATAAAGTTAGCTGG - Intergenic
1146196273 17:30815701-30815723 AAAAATACAAAAAAGTTAGGTGG - Intronic
1146475766 17:33161508-33161530 GAAGATAAAATACAGTGATGTGG - Intronic
1147012774 17:37464844-37464866 AAAAAAAAAAGACAGTGAGGTGG + Intronic
1147064933 17:37915684-37915706 AATAATAAAATACAGTGAGGTGG + Intergenic
1147223693 17:38957827-38957849 AAAAATAAAATAAAATTAGCTGG - Intronic
1147359620 17:39922708-39922730 AGATATAAAAGACTGTTGGGAGG + Intronic
1147408539 17:40231865-40231887 AGATTTAAAATACAATTACGAGG - Intronic
1147773960 17:42887305-42887327 AAATATAAAAAAAAATTAGCTGG + Intergenic
1147840936 17:43370964-43370986 AAATAAAAAATAGAGAGAGGGGG + Intergenic
1147991346 17:44335569-44335591 AAAAATAAAATAAAATTAGTCGG + Intergenic
1148223354 17:45880846-45880868 AAAAATAAAATAAAATTAGCTGG + Intergenic
1148254839 17:46121168-46121190 AAAAAAAAAAAAGAGTTAGGGGG - Intronic
1149932665 17:60771106-60771128 AAATACAAATTTCAGTTTGGGGG - Intronic
1150251615 17:63708036-63708058 AAATATAAAAATTAGTTGGGCGG - Intronic
1151653136 17:75482182-75482204 AAATATAAAAAAAAATTAGCCGG + Intronic
1151659847 17:75513281-75513303 AAATATAAAAAAAAATTAGCCGG + Intronic
1152060422 17:78069543-78069565 AAATAAAAAATAAAATTAGTTGG - Intronic
1152080758 17:78186098-78186120 AAAAATAAAATAAAATTAGCTGG + Intronic
1152370406 17:79884596-79884618 AAAAAAAAAAAACAGTTAGCTGG + Intergenic
1152393203 17:80015270-80015292 AAATAGAAAAAAAAGTTAGCCGG + Intronic
1152615991 17:81338127-81338149 AAAAATAAAATAAAATTAGCTGG - Intergenic
1152668388 17:81585825-81585847 AAAAATACAAAAGAGTTAGGTGG + Intronic
1153112292 18:1606210-1606232 AAAAATAAAAAATAGTTAGCTGG - Intergenic
1153279840 18:3404515-3404537 AAATACAAAATAAAATTAGCTGG + Intergenic
1153440318 18:5110554-5110576 AAATATAAGATAAAGTTAAAAGG - Intergenic
1153911744 18:9710693-9710715 AAATACAAAAAAAAGTTAGCTGG + Intronic
1154363391 18:13684235-13684257 AAATATAAAAAAAAATTAGCCGG + Intronic
1154964172 18:21340256-21340278 AAATATAAAAAAAAATTAGCCGG + Intronic
1155462431 18:26097963-26097985 AAATAAAAAATAAAATTAGCTGG + Intergenic
1155521990 18:26677488-26677510 AAATAGAAAAAAAAGTTAGCTGG + Intergenic
1155790601 18:29964592-29964614 AAAGAGAAAATACAGTTTAGAGG + Intergenic
1155795353 18:30029178-30029200 AAATATAAAATATATTTGGAGGG + Intergenic
1156000578 18:32379755-32379777 AAATGGAAAATACACTTGGGGGG + Intronic
1156043306 18:32848786-32848808 AAATATTAGAGACAGTGAGGTGG + Intergenic
1156320270 18:36014579-36014601 AAATACAAAAAACAATTAGCCGG + Intronic
1156444968 18:37229698-37229720 AAATACAAAATACAGAGATGGGG - Intronic
1156507140 18:37604784-37604806 AAATAAATAATACAGTTAGGAGG + Intergenic
1156728568 18:40161061-40161083 AAAAATAAAACACACTTTGGTGG - Intergenic
1156795109 18:41035265-41035287 AAAAATAAAAAAAAATTAGGCGG - Intergenic
1157546699 18:48551556-48551578 AAAGATGAAATACACTTAGGGGG - Intronic
1157767680 18:50313174-50313196 AAAAATAAAATAAAGTTAGTTGG - Intergenic
1158237633 18:55336863-55336885 AAACATTAAACACAGTAAGGAGG + Intronic
1158439316 18:57460082-57460104 AAAAATAAAATAAAATTAGCTGG - Intronic
1158445809 18:57519527-57519549 AAATACAAAAAACAATTAGCCGG - Intergenic
1158479367 18:57806653-57806675 AAATACAAAATAAAATTAGCTGG + Intergenic
1158715503 18:59875672-59875694 AAATACAAAAAAAAGTTAGCCGG - Intergenic
1158736801 18:60091603-60091625 GGATATAACATACATTTAGGGGG + Intergenic
1159091153 18:63850936-63850958 AAACAGAAAATACAGTTCAGAGG - Intergenic
1159218803 18:65432082-65432104 AAATATAAAATACAGGTTTTAGG + Intergenic
1159566829 18:70060707-70060729 GGGTACAAAATACAGTTAGGAGG - Intronic
1159910319 18:74139220-74139242 AGATTTAAAATACAGTAAGCTGG - Intronic
1160795767 19:944785-944807 AAAAATAAAATGAAGTTAGCCGG - Intronic
1160955555 19:1690055-1690077 AAATATAAAAAAAAATTAGCCGG - Intergenic
1161202201 19:3021555-3021577 AAATATAAAATAAATTTAATAGG + Intronic
1161604263 19:5205922-5205944 ACATATCAAATACAGTTCTGAGG - Exonic
1161864783 19:6825892-6825914 AAATACAAAAAACAATTAGCTGG + Intronic
1162160812 19:8713964-8713986 AAATACAAAAAAAAGTTAGCTGG - Intergenic
1162653203 19:12107432-12107454 AAATATAAAAAAAAATTAGCTGG + Intronic
1162814357 19:13184299-13184321 AAATAAAAAAAACAATTAGCCGG - Intergenic
1162953770 19:14087278-14087300 AAATATAAAAAAAAATTAGCTGG - Intergenic
1163231996 19:16010247-16010269 AAATATAAAAAAAAATTAGCTGG + Intergenic
1163279830 19:16308896-16308918 AAATATAAAATAAAATTGGCCGG + Intergenic
1163526074 19:17822202-17822224 AAATAAAAAATAAAAATAGGTGG - Intergenic
1163749832 19:19069985-19070007 AAATAAAAAATAAAATTAGCTGG - Intronic
1163931217 19:20393799-20393821 AAAAATACAAAACAATTAGGCGG - Intergenic
1163972754 19:20815455-20815477 AAATACAAAAAATACTTAGGAGG + Intronic
1163986506 19:20957368-20957390 AAATATAAAAGTTAGTTAGCGGG - Intergenic
1164582794 19:29445151-29445173 AAAAATAAAATAAAATTAGCTGG - Intergenic
1165504980 19:36220664-36220686 TACTATAAAATACAACTAGGAGG - Intronic
1165684076 19:37802858-37802880 AACTCTAAAATACAGTTATATGG - Intronic
1165920603 19:39295585-39295607 AAATAAATAATAAAGTAAGGTGG + Intergenic
1166067537 19:40368761-40368783 AAAAATAAAAAAAAATTAGGAGG + Intronic
1166276966 19:41760840-41760862 ACACAGAAAATACAGCTAGGGGG + Intronic
1166551923 19:43671337-43671359 AAAAATAAAATAAAATTAGCTGG + Intergenic
1166820376 19:45575763-45575785 AAAAATAAAAAACAATTAGTGGG - Intronic
1167132275 19:47594712-47594734 AAATATAAAACAAAATTAGCCGG - Intergenic
1167274065 19:48524680-48524702 AAAAATAAAATACAGAAAGTGGG + Intergenic
1167611352 19:50509237-50509259 AAATAAAAAATAAAATTAGCTGG - Intronic
1167688388 19:50970227-50970249 AAATACAAAAAACATTTAGCCGG - Intergenic
1167836896 19:52080320-52080342 AAATCCAGAAAACAGTTAGGAGG + Intronic
1167986467 19:53322291-53322313 AAATAAAAAATACACTTGAGAGG - Intergenic
1168244011 19:55101260-55101282 AAATAAAAAATGCAGTCAGTAGG + Intronic
1168298988 19:55392686-55392708 AAATACAAAAAACATTTAGCCGG - Intronic
1168371819 19:55841701-55841723 AAATACAAAAAAAAGTTAGCCGG + Intronic
1168477776 19:56689958-56689980 AAAAAAAAAATACAGTCACGAGG - Intergenic
1168485199 19:56755626-56755648 AAATACAAAAAAAAGTTAGCCGG - Intergenic
1168524379 19:57077155-57077177 AAAAGTAAAATAAAATTAGGCGG - Intergenic
1168564926 19:57414870-57414892 AAATACAAAAAAAAGTTAGCCGG - Intronic
1168593366 19:57654609-57654631 AAATAAAAAATCCAGGTAGTTGG - Intergenic
1168632420 19:57967848-57967870 AAATACAAAATAAAATTAGCTGG + Intronic
925665487 2:6250842-6250864 AAAAATACAAAACAGTTAGCTGG + Intergenic
925677261 2:6376537-6376559 AAAGAAAAAACAAAGTTAGGAGG + Intergenic
926209020 2:10855133-10855155 AAATACAAAATGAAGGTAGGGGG - Intergenic
926467750 2:13212864-13212886 AAATATAAAATACAGGGAGGTGG + Intergenic
926583217 2:14654979-14655001 AAAGAGAAAATAGAGTTGGGAGG - Intergenic
926999327 2:18776120-18776142 AAATATATATTACAGTTACTCGG + Intergenic
927163851 2:20297199-20297221 GAAAATAAAATAGAGGTAGGTGG - Intronic
927187674 2:20493580-20493602 AAAAATAAAATATAGTAAGGAGG + Intergenic
927347062 2:22057297-22057319 AAAAATAAAATACAAATAGAGGG + Intergenic
927477440 2:23424497-23424519 AAACATAAAAAACATTTATGTGG + Intronic
927756831 2:25715415-25715437 AAAAATAAAACCCAGTTTGGGGG + Intergenic
928185265 2:29104435-29104457 AAAAATAAAATAAAATTAGCTGG - Intronic
928406662 2:31020232-31020254 AATTAAAAAATACAGTTCTGTGG - Intronic
928570556 2:32603556-32603578 AAATACAAAATACAATTAGCCGG + Intronic
928739493 2:34333407-34333429 TAATATGAAGTACAGTTTGGAGG + Intergenic
929009721 2:37429062-37429084 AAATAAAAAATAAATTTAAGTGG - Intergenic
929237300 2:39619379-39619401 AAATACAAAAAACAATTAGCTGG - Intergenic
929519374 2:42633730-42633752 AAATACAAAAAAAAGTTAGCCGG + Intronic
930287567 2:49450792-49450814 AAAGATAAAAGAAAGCTAGGAGG + Intergenic
930364494 2:50422809-50422831 AAATATACAAGGCAGTTACGTGG + Intronic
930651084 2:53965829-53965851 AAATACAAAAAAAAGTTAGCCGG - Intronic
930765674 2:55083020-55083042 AAATATATAATGCAGCTTGGTGG - Intronic
930969577 2:57378716-57378738 AAATACAAAAAACAATTAGCCGG + Intergenic
931002892 2:57808864-57808886 AAATGTAAAATACAATGAGTGGG + Intergenic
931006301 2:57853591-57853613 AAATTTAAAGAACATTTAGGAGG - Intergenic
931057886 2:58493259-58493281 AAATAATAAATAAAGTTAGCTGG + Intergenic
931279052 2:60772283-60772305 AAAAATAAAAAACATTTAGTTGG + Intronic
931334301 2:61323350-61323372 AAATACAAAAAAAAGTTAGCTGG + Intronic
931470058 2:62530641-62530663 AAAAATAAAATATCGTTAGTTGG + Intergenic
931815572 2:65897419-65897441 AAATATATAAGGCAGTTAGAAGG - Intergenic
931861238 2:66356684-66356706 AAACATAAAATACAGTGTTGTGG - Intergenic
932201786 2:69834835-69834857 AAATCCAAAATCCAGTTAAGAGG - Intronic
932375717 2:71234030-71234052 AAATAAAAAAGAAAGTTAGATGG + Intergenic
932415135 2:71569032-71569054 AAATACAAAATAAAATTAGCTGG - Intronic
932505003 2:72220364-72220386 AACTAGAAAATACAGGAAGGAGG + Intronic
932789377 2:74640386-74640408 AAATATAAAATACAAGTCGAGGG + Intronic
932819027 2:74883988-74884010 AAACATAAAATACAATTAATGGG + Intronic
933078441 2:77958024-77958046 CACTATAAAAAACAGTTTGGAGG + Intergenic
933495705 2:83047736-83047758 AAATACAAAAAAAAGTTAGCCGG + Intergenic
933864827 2:86506766-86506788 AAATATAAAAATTAGGTAGGTGG - Intronic
934097183 2:88617593-88617615 AAATATAAAAAAAAATTAGCCGG + Intronic
935663845 2:105493037-105493059 AGAAATAAAATTCAGTTAGAAGG - Intergenic
935785291 2:106543366-106543388 AAAAATAAAATAAAATTAGCCGG + Intergenic
935832682 2:107017086-107017108 AAATATAAAAAAAAATTAGCTGG - Intergenic
935889764 2:107663594-107663616 AAATAGAAAATAAAATTAGCTGG - Intergenic
935890243 2:107669248-107669270 AAAAGTAAAATACGGTTGGGTGG - Intergenic
936150280 2:110015511-110015533 AAAAATAAAATAAAATTAGTTGG - Intergenic
936194394 2:110355864-110355886 AAAAATAAAATAAAATTAGTTGG + Intergenic
937846829 2:126587690-126587712 AAAAATAAAATAAAATTAGCCGG + Intergenic
938034449 2:128024897-128024919 AAAAATAAAATAAAATTAGCTGG + Intronic
938272541 2:129986704-129986726 AAATTTAAAATAGAGTAAGAGGG - Intergenic
938296025 2:130180123-130180145 AAATACAAAAAACAATTAGCCGG - Intronic
938460721 2:131494539-131494561 AAATACAAAAGACAATTAGCCGG + Intergenic
938814354 2:134884758-134884780 AAGTATATAATACAGTTTAGAGG - Intronic
939078784 2:137634952-137634974 AAAAATAATAGACAGTGAGGTGG - Intronic
939395789 2:141628038-141628060 AAAGATAATCCACAGTTAGGTGG + Intronic
939427902 2:142064211-142064233 AAAAATAGAGTACAGATAGGTGG - Intronic
939487349 2:142831312-142831334 AGATATAAAATAAAATTAGCTGG - Intergenic
939891098 2:147737155-147737177 AAAAAAAAAATACAGTTAGGTGG + Intergenic
939914853 2:148026626-148026648 AAATAAAAAATAAGGTCAGGTGG + Intronic
940014800 2:149092841-149092863 AAATAAAAAATACCTTGAGGTGG - Intronic
940199291 2:151132272-151132294 AAATACAAAAAAAAGTTAGCCGG + Intergenic
940541325 2:155023411-155023433 AAATTAAAAATAAAGTTAGACGG - Intergenic
940600375 2:155851256-155851278 AAATAAAAAATAAAGAGAGGGGG + Intergenic
941146643 2:161855142-161855164 ACCTATAAAATACACTAAGGGGG - Intronic
941246655 2:163106404-163106426 AAATACAAAAAACAATTAGCCGG - Intergenic
941590945 2:167419553-167419575 AAATATAAAAGACAATTATGAGG + Intergenic
941652999 2:168113497-168113519 AATTATAAATGACAGTGAGGTGG + Intronic
941662108 2:168205655-168205677 AAAAATAAAATAAAATTAGCCGG + Intronic
941790691 2:169548933-169548955 AAATACAAAAAAGAGTTAGCCGG + Intronic
941845922 2:170132869-170132891 AAATAAAAAATACAATCAAGAGG + Intergenic
942066873 2:172279792-172279814 AAATATAAATTTCTGTAAGGAGG + Intergenic
942103395 2:172608580-172608602 AAAAATAAAAGATAGTTTGGAGG - Intronic
942113209 2:172702592-172702614 AAAAAAAAAAGGCAGTTAGGAGG - Intergenic
942166864 2:173249775-173249797 CAATTTCAAATACAGTTAAGGGG + Intronic
942793720 2:179791917-179791939 AAATACAAAAAACAATTAGCTGG - Intronic
943217081 2:185051628-185051650 AAAAAAAAGTTACAGTTAGGAGG - Intergenic
943299734 2:186183281-186183303 AGAAATCAAATACAGTTATGAGG - Intergenic
943805270 2:192117362-192117384 AAATTTAAAATACTGGTAGTAGG + Intronic
943892662 2:193310185-193310207 AAAAATAAAATAAAATTAGCTGG + Intergenic
944076782 2:195741902-195741924 AAATTTAAAATTCAGTTATTTGG - Intronic
944097785 2:195989257-195989279 CAATATAGAAAACAGTAAGGAGG - Intronic
944104046 2:196060054-196060076 AAATACAAAAAACAATTAGCCGG + Intronic
944568711 2:201019926-201019948 AAATAAAAAATAAAATTAGCAGG + Intronic
945290127 2:208118585-208118607 AAATACAAAATAAAATTAGCCGG + Intergenic
945442916 2:209901765-209901787 AAATACAAAATAAAATTAGCCGG + Intronic
945567362 2:211417314-211417336 AAATATAAAAAAAAATTAGCTGG + Intronic
945952204 2:216050058-216050080 AAATATAAAAAAGAATTAGCTGG + Intronic
945969761 2:216224001-216224023 AAATATAAAGGAGAGTAAGGAGG + Intergenic
946246280 2:218389555-218389577 AAAAATAAAATAAAGTAAGCTGG + Intronic
947506455 2:230711913-230711935 AAATACAAAAAACAATTAGCCGG - Intergenic
947685538 2:232080910-232080932 AAAAAAAAAATACAGTTGGTTGG + Intronic
947974201 2:234350554-234350576 AAATATAAAAAAAAATTAGCTGG - Intergenic
948030026 2:234809822-234809844 AAATAGAGAATGCAGTAAGGAGG - Intergenic
948090454 2:235289500-235289522 AAAGATAAATGACAATTAGGAGG + Intergenic
948919608 2:241056740-241056762 AAATATAAAAAAAAATTAGCCGG - Intronic
948957345 2:241303968-241303990 AAATATAGAAAAAAGTTAGCTGG - Intronic
1168858058 20:1023339-1023361 AAAAAGAAAATGCAGTTACGTGG + Intergenic
1169097631 20:2917112-2917134 AAATACAAAATTTAGTTGGGCGG - Intronic
1169100130 20:2940261-2940283 AAATACAAATAACAGTTAAGGGG + Intronic
1169380845 20:5105902-5105924 AAATAAAAAATAAAATTAGCTGG + Intronic
1169772854 20:9220472-9220494 AAATACAAAAAAAAGTTAGCTGG + Intronic
1169840049 20:9925991-9926013 AAGTTTAAATTACAGGTAGGAGG + Intergenic
1170238359 20:14133558-14133580 AAAAATAAAACACAGTAAAGAGG + Intronic
1170470905 20:16667122-16667144 AAATACAAAAAACAATTAGCCGG - Intergenic
1170613489 20:17932076-17932098 AAATAAAATAAACAGTTTGGGGG + Intergenic
1170907102 20:20526190-20526212 AAATATCAAATACAGTAAAAAGG + Intronic
1170914322 20:20607912-20607934 AATGGTAAAATACAGTTGGGTGG + Intronic
1171112290 20:22495168-22495190 AAATATAAAATACAGGCATCTGG + Intergenic
1171491508 20:25522065-25522087 AAAAATAAAAAACAATTAGCTGG - Intronic
1171536566 20:25898286-25898308 AAAAATAAAAGACAATTAGATGG + Intergenic
1171773270 20:29343564-29343586 AAATACAAAAAAAAATTAGGTGG + Intergenic
1171839506 20:30193551-30193573 AAAAATAAAAAACAATTAGATGG + Intergenic
1172495358 20:35378634-35378656 AAAGATAAAAAAGAGTTAGAAGG + Intronic
1172579598 20:36036421-36036443 AAATATAAAAAAAAATTAGCTGG + Intergenic
1172820958 20:37733735-37733757 ATATACAAAATACAGTAATGAGG - Intronic
1172976850 20:38912512-38912534 AAAAAAAAAAAACAATTAGGTGG + Intronic
1172981928 20:38949978-38950000 AAATACAAAAAAAAGTTAGCTGG - Intronic
1173383876 20:42570745-42570767 AAATGAAAAATAGAGTCAGGAGG - Intronic
1173924490 20:46770723-46770745 AAATATAAAATACAGGAAATGGG + Intergenic
1174029396 20:47609864-47609886 AAATATAAAATACTGCAAAGAGG - Intronic
1174097626 20:48101938-48101960 AAATACAAAAGAAAATTAGGCGG - Intergenic
1174483636 20:50848064-50848086 AAACAGAAAATTCAGTTAGATGG + Intronic
1174667982 20:52278143-52278165 AAATACAAAAAAAAGTTAGCCGG - Intergenic
1175087489 20:56472059-56472081 AAAAATAAAATAAAATTAGCTGG + Intronic
1175849469 20:62081203-62081225 AAATACAAAAAATAGTTAGCCGG + Intergenic
1176936846 21:14877210-14877232 TAAAATGAAATACAGTTGGGAGG - Intergenic
1176946410 21:14987677-14987699 AAATGTAAAATACACTTTGTAGG - Intronic
1177163605 21:17575650-17575672 AAATATAAAAAAAAATTAGCTGG - Intronic
1177165984 21:17604281-17604303 AAATATAAAAAAAAATTAGCCGG + Intronic
1177640303 21:23836156-23836178 AAAAAAAAAATTTAGTTAGGAGG + Intergenic
1177809487 21:25910287-25910309 AAATACAAAAAAAAGTTAGCCGG - Intronic
1178046389 21:28699040-28699062 AAATATGAAATAATATTAGGAGG - Intergenic
1178080429 21:29058277-29058299 AAATACAAAAAAAAATTAGGTGG + Intronic
1178215841 21:30597545-30597567 AAATATAAAAAAAAATTAGCCGG - Intergenic
1178365876 21:31988359-31988381 AAATGTCAAATCCAGCTAGGAGG + Intronic
1178547378 21:33503672-33503694 AAATACAAAAAATAGTTAGCTGG - Intergenic
1178945311 21:36942014-36942036 AAATACAAAATTTAGCTAGGTGG + Intronic
1179464837 21:41564718-41564740 AAATATACAAAAAAGTTAGCTGG + Intergenic
1180462550 22:15579436-15579458 AAATTTAAAATAGAGTAAGAGGG + Intergenic
1180993075 22:19950373-19950395 AAATATAAAATAGGGCTGGGTGG - Intronic
1181158907 22:20944873-20944895 AAATACAAAAAAAAGTTAGCTGG - Intronic
1181263875 22:21618747-21618769 AAATAAAAAATAAAATTAGCCGG - Intronic
1181344674 22:22210245-22210267 AAATATAAAAGCCAGTAAGTTGG - Intergenic
1182056031 22:27355339-27355361 AAAAATAAAAAAGAGTTGGGTGG + Intergenic
1182231701 22:28842265-28842287 AAAAATAAAATAAAATTAGCAGG + Intergenic
1182384887 22:29929669-29929691 AAATACAAAAAAAAGTTAGCCGG - Intronic
1182556273 22:31130359-31130381 AAAAATAAAATTTAGCTAGGTGG + Intronic
1183056859 22:35312093-35312115 AAATACAAAAAAAAATTAGGCGG + Intronic
1183145880 22:35991203-35991225 AAAAATAACATGCAGTTAAGAGG + Intronic
1183500140 22:38173888-38173910 AAATATAAAATAAAATTAGCTGG + Intronic
1183699081 22:39439866-39439888 AAAAATAAAATAAAATAAGGTGG - Intergenic
1183905545 22:41037586-41037608 AAAAATAAAATAAAATTAGCTGG + Intergenic
1184580207 22:45412174-45412196 AAATATAAAATAAAATTGGCCGG - Intronic
1184621850 22:45685900-45685922 AAATTTAAAATACAGTTAATTGG + Intronic
949149489 3:748078-748100 AAATATATAATACAGTCATACGG - Intergenic
949251858 3:1994835-1994857 TATTTTAAAACACAGTTAGGAGG + Intergenic
949336075 3:2977473-2977495 GAGTATAAAAGACAGTTTGGGGG - Intronic
949338109 3:2999017-2999039 AAATATAAAAAATATTTATGTGG - Intronic
950009700 3:9714088-9714110 AAATAAATAATAAAGATAGGTGG + Intronic
950027213 3:9828510-9828532 AAATATAAAAAACAGTGAAGTGG + Intronic
950292223 3:11794296-11794318 AAAAATAAAATAAAATTAGCCGG - Intronic
950311717 3:11964572-11964594 AAATATAAACTACTGTTACTTGG - Intergenic
950508819 3:13413306-13413328 AAATACAAAAAAAAGTTAGCCGG + Intronic
950741542 3:15056344-15056366 AAATTTAAAAGACAATTTGGTGG + Intronic
950807383 3:15618115-15618137 AAAAATAAAATTAAGTTAGCTGG - Intronic
950876233 3:16277084-16277106 AAATACAAAAAAAAGTTAGCCGG - Intronic
951052320 3:18108131-18108153 AAGCATATAATACAGTTAGAAGG - Intronic
951164259 3:19466084-19466106 AAATATAAAAAAGAATTAGCCGG - Intronic
951614855 3:24531108-24531130 AACAATAGAATACAGTTAGGAGG + Intergenic
951925356 3:27903175-27903197 AGAAAAAAATTACAGTTAGGTGG + Intergenic
952554621 3:34518274-34518296 AAATATGAAATAATGTTAGGTGG + Intergenic
952762796 3:36930034-36930056 AAATACAAAAAAAAGTTAGCCGG - Intronic
953520924 3:43642574-43642596 AAATATATAAAACATTTATGTGG + Intronic
953636185 3:44667021-44667043 AAATACAAAAAACAATTAGCTGG - Intergenic
954391911 3:50272104-50272126 AAAAATAAAATAAAATTAGCTGG + Intronic
954567960 3:51614850-51614872 TAATATTAAAGACTGTTAGGGGG - Intronic
954788213 3:53110639-53110661 AAACAAAAAATACAGATGGGGGG + Intronic
954788980 3:53116761-53116783 AAAAATACAAAACAGTTAGCTGG - Intronic
955050979 3:55410626-55410648 AAATGTAAAACACAATTAGAGGG - Intergenic
955165745 3:56509631-56509653 AAATACAAAATAAAATTAGCCGG + Intergenic
955496262 3:59536220-59536242 AGGAATAAAATACAGTTTGGAGG - Intergenic
956857484 3:73289759-73289781 AAAAATAATATATAGTTAGATGG - Intergenic
956886274 3:73563333-73563355 AAATAGAAAATATAATTTGGCGG - Intronic
957046192 3:75376965-75376987 AAATATAATAAAAAGTTAGCCGG - Intergenic
957535812 3:81501854-81501876 AAATATAAAAATCAGTCTGGTGG - Intronic
957805062 3:85136275-85136297 AAATAAAAGCTACATTTAGGAGG - Intronic
957994339 3:87670011-87670033 AAAAATACAGTGCAGTTAGGTGG - Intergenic
958112536 3:89167287-89167309 AAATATAAAATACATATACTTGG + Intronic
958664967 3:97125607-97125629 AAATATAGAATATAGTTACCAGG + Intronic
958805595 3:98806287-98806309 AAATAGAAAATACAGGTATTTGG + Intronic
958826224 3:99034771-99034793 AAATTTAAAAAAAATTTAGGGGG + Intergenic
959014432 3:101117327-101117349 AAATATTACATACATTTAGGGGG + Intergenic
959014972 3:101123513-101123535 AAATAAAAAATAAAGTTCAGAGG - Intergenic
959472968 3:106775280-106775302 ATATATAAAATTCCTTTAGGAGG + Intergenic
959528529 3:107405515-107405537 CAATATAAAATAATGGTAGGTGG - Intergenic
960010083 3:112824310-112824332 AGATATAAAATACAGATATAGGG + Intronic
961224349 3:125226363-125226385 AAATATAGAATACAGTTTTATGG - Exonic
961688431 3:128651209-128651231 AAATATAAAAAAAAATTAGCCGG - Intronic
961691107 3:128670384-128670406 AAATATAAAAAAAAATTAGCCGG - Intronic
961742876 3:129045205-129045227 AAAAATAAAATAAAATTAGCTGG + Intergenic
962405772 3:135098852-135098874 AAATACAAAAATTAGTTAGGTGG + Intronic
962561017 3:136606907-136606929 AAATACAAAAAAAAGTTAGCCGG - Intronic
962952547 3:140232700-140232722 CAATATTAAATACAATAAGGGGG - Intronic
963101660 3:141612430-141612452 AAATATTAAATACAATGTGGAGG - Exonic
963308271 3:143678285-143678307 AAAAAGAAAATACATTTAAGTGG - Intronic
963371240 3:144403244-144403266 AAAAAAAAAATTCTGTTAGGTGG - Intergenic
963675144 3:148301360-148301382 AAATATAAAATAAGGTCAGAAGG - Intergenic
963932410 3:151017386-151017408 AAATACAAAAAACAATTAGCGGG + Intergenic
964506175 3:157402249-157402271 AAATACAAAATAAAGCTAGGGGG - Intronic
964958745 3:162395944-162395966 AAATGTAAAATACAGTAAATTGG + Intergenic
965005717 3:163019825-163019847 AAAAAAAAAATACAGTGGGGAGG - Intergenic
965536161 3:169825582-169825604 AAATATAAAGTACATGTGGGAGG + Intronic
966290664 3:178354025-178354047 AAAGAAAAAATATAGCTAGGAGG + Intergenic
966291912 3:178369440-178369462 AAATATAAAATCCATTGATGAGG + Intergenic
966406002 3:179599005-179599027 AAATAAAAAATATAATTAGCCGG + Intronic
966637256 3:182149425-182149447 AAATAAAAAGTGCAGGTAGGCGG - Intergenic
966664061 3:182450771-182450793 AGAGATAAAACACAGTGAGGAGG - Intergenic
967020208 3:185515970-185515992 AAACAAAAAAAACAGTTAGCTGG + Intronic
967053299 3:185804828-185804850 AAATATAAAAAAAAATTAGCTGG + Intronic
967627167 3:191700394-191700416 AATTATAAAATACTGCTAAGAGG - Intergenic
967724576 3:192849620-192849642 AAATATTAAATAAAGTAAGACGG - Intronic
968179337 3:196580157-196580179 AAATATAAAATTAAATTAGCCGG - Intronic
968385490 4:132877-132899 ACACATAAAATACAGTAACGTGG + Intronic
968408836 4:367364-367386 AAATAGAAAGTAAAATTAGGAGG - Intronic
968677284 4:1890458-1890480 AAATACAAAAAACAATTAGCCGG - Intronic
968990477 4:3908083-3908105 AAATATAATAAAAAGTTAGCCGG - Intergenic
969034619 4:4243239-4243261 AAATACAAAAAACAATTAGCTGG - Intronic
969824850 4:9749259-9749281 AAATATAATAAAAAGTTAGCCGG + Intergenic
970520282 4:16876638-16876660 AAATATAACATACAGGTTTGTGG + Intronic
970662388 4:18300323-18300345 CTATATAAAATATTGTTAGGAGG - Intergenic
971404975 4:26313940-26313962 AAATATAAAACATAGAAAGGAGG - Intronic
971691715 4:29845262-29845284 AAATATAAAATAGATTTAACTGG - Intergenic
971758258 4:30730591-30730613 AAATAATAAATACACTTGGGGGG - Intronic
971852543 4:32001650-32001672 AAATATAAAATAAAATTAAAGGG + Intergenic
972041219 4:34602619-34602641 AAATAAAAAATAAAATTAGCTGG - Intergenic
972431987 4:38991739-38991761 AAATATAAAATACAGTTAGGTGG + Intronic
973031188 4:45342307-45342329 AAAAATAAAATAGAGATAGAGGG + Intergenic
973084504 4:46039326-46039348 AAAAAAAAAATAGAGTTAGCTGG + Exonic
973226323 4:47789140-47789162 AAATACAAAATAAAATTAGCTGG + Intronic
973264743 4:48200024-48200046 TAAAATAAAATAGAGATAGGTGG + Intronic
973574468 4:52273215-52273237 AAAATTAAAATACAGTTACTGGG + Intergenic
973629902 4:52810734-52810756 ACATATAAAAAAAAATTAGGTGG + Intergenic
973890100 4:55360051-55360073 AAATACAAAAAAAAGTTAGCTGG + Intronic
974044183 4:56883820-56883842 AAATATAAAAAAGAATTAGCTGG + Intergenic
974119975 4:57626537-57626559 AAATAAAAAAGACATATAGGTGG + Intergenic
974389605 4:61249153-61249175 AAATAGAAATTACAGTGAAGTGG + Intronic
974420656 4:61668855-61668877 AAAAAGTAAATACAATTAGGTGG + Intronic
974467376 4:62274378-62274400 ATATATAAAATAAATTTAGGAGG - Intergenic
974473034 4:62342714-62342736 AAATATAAAATCCTATTTGGAGG - Intergenic
975045319 4:69796313-69796335 AAATATAAAAAAAAATTAGCCGG - Intergenic
975233569 4:71964097-71964119 AAATACAAAAAAAAGTTAGCCGG - Intergenic
975404505 4:73974732-73974754 AAATATAAAATACATTTGAAAGG - Intergenic
975524087 4:75330590-75330612 AAATACAAAAAAAAGTTAGCTGG - Intergenic
975669499 4:76766728-76766750 AATTTTAAAATGCAGTTAAGAGG - Intronic
975775518 4:77782492-77782514 AAAAATAAAATAAAATTAGCTGG - Intronic
976137743 4:81957304-81957326 AAATACAAAAAAAAGTTAGCTGG - Intronic
976347121 4:84016958-84016980 AAGTATAAAATACAGGTCGAAGG + Intergenic
976512574 4:85928617-85928639 AAATACAAAAAAAATTTAGGTGG - Intronic
976689040 4:87848516-87848538 AAAAATAAAAGACAATTTGGGGG + Intergenic
976878395 4:89886958-89886980 GGATACAAAATACAGTTAGATGG - Intronic
977039169 4:91993567-91993589 AAATGTAAAAAACAATTAGCCGG + Intergenic
977377902 4:96231355-96231377 AAATATATAATAAAATTTGGAGG + Intergenic
977700288 4:100014337-100014359 AAATACAAAAAACAATTAGCTGG + Intergenic
978166005 4:105607774-105607796 AAATAAAAAAGACAGTTTGTCGG + Intronic
978458644 4:108925261-108925283 AAATATAAAATTGTGTCAGGTGG + Intronic
978647005 4:110946026-110946048 AAATAAAAAATAAAGCTAAGTGG + Intergenic
978654028 4:111045103-111045125 AAAAATAACAAAAAGTTAGGCGG + Intergenic
979072657 4:116229154-116229176 AAATACAGAATACAGTAATGGGG + Intergenic
979127615 4:116995552-116995574 ATATATAAAATACAGTTTTTTGG - Intergenic
979786975 4:124727800-124727822 AGATATAAAATATATTTAGTAGG - Intergenic
980716658 4:136637478-136637500 AAAAAAAAAATACAGTTAAAGGG - Intergenic
980804262 4:137791435-137791457 AAATAAAAAATTCAATTAGGTGG + Intergenic
980839785 4:138244244-138244266 AAAAAAAAAATACTGTGAGGAGG - Intergenic
981059257 4:140403935-140403957 AAATAGCAATTACTGTTAGGTGG + Intronic
981465158 4:145060652-145060674 AAAAATAAAAAAGATTTAGGTGG + Intronic
981830790 4:148998893-148998915 GAATATAAATTACAGCCAGGGGG + Intergenic
982488191 4:155994621-155994643 AAATATAAAATAGAGGAATGAGG - Intergenic
982509128 4:156258834-156258856 AAATTTAAAATACAGTTGTTGGG + Intergenic
982525550 4:156473411-156473433 AAATAAAAAATGTAGTAAGGTGG - Intergenic
982586936 4:157253428-157253450 TAATGTAAAATACAGTAAGTGGG + Intronic
982599831 4:157434192-157434214 AAATAAAAAATAAATTTAGTTGG + Intergenic
983069174 4:163249003-163249025 AAATATAAAAGACAATAAAGAGG + Intergenic
983632057 4:169859624-169859646 ACATATAAACAACAGTGAGGTGG - Intergenic
983695167 4:170519200-170519222 AAAAATAAAATAAAATTAGCCGG + Intergenic
983784082 4:171710164-171710186 AAATATAAAAAAAAATTAGCAGG - Intergenic
983984904 4:174046983-174047005 GAAAAAAAAATACTGTTAGGAGG + Intergenic
984001372 4:174250628-174250650 AAATGTACACTACAGTTAGCTGG + Intronic
984019060 4:174462530-174462552 AAATATGAAATGCAATTAGGTGG + Intergenic
984284846 4:177716289-177716311 AAAAAAAAAATAGAGTTGGGTGG - Intergenic
984431067 4:179649817-179649839 AAAATTAAAGTATAGTTAGGAGG - Intergenic
984693291 4:182753246-182753268 AAATTAAAAATTCAGTAAGGAGG - Intronic
985066773 4:186130155-186130177 AAATACAGAACACAGATAGGAGG + Intronic
985214998 4:187642301-187642323 AAACATAAAATATATTTAGGGGG + Intergenic
985378410 4:189366353-189366375 AAAAATAAAAAAAAATTAGGTGG + Intergenic
985898775 5:2769086-2769108 AAATACAAAAAACAATTAGCCGG - Intergenic
986185844 5:5436775-5436797 GGCTATAAAATACTGTTAGGAGG - Intronic
986391718 5:7293516-7293538 AAATATAAAATACAGTGGCCGGG + Intergenic
986587130 5:9330132-9330154 AAAAAAAAAATACAGATGGGAGG + Intronic
986615080 5:9607657-9607679 AAATATAAATTAAAATGAGGTGG - Intergenic
986620992 5:9674163-9674185 GCATATAAAATACAGTTATTGGG - Intronic
987481988 5:18471313-18471335 AAATACAAAATGCAATTAGAGGG - Intergenic
987507804 5:18795729-18795751 AAATATTATATTCAGTTTGGTGG - Intergenic
987569147 5:19632975-19632997 AATTAGAAAATACAGTGTGGTGG + Intronic
987571808 5:19673645-19673667 AAATATAAAATACAGAAAGCTGG - Intronic
987603914 5:20108239-20108261 AAAAATAAAATAAAATTAGCCGG - Intronic
988020230 5:25611859-25611881 TAATATATAATTCAGTTATGAGG + Intergenic
988136331 5:27175965-27175987 AAAAATAAAATAAAATTAGCAGG - Intergenic
988266364 5:28956043-28956065 AAATATAAAACATAATTTGGGGG - Intergenic
988285571 5:29212060-29212082 GATTATAAAATACAATTAAGAGG + Intergenic
988372474 5:30388962-30388984 ACACATAAAATACAGTCAAGTGG + Intergenic
988390824 5:30628055-30628077 AAATATACAATACTGTTAGTTGG - Intergenic
988880061 5:35492495-35492517 TAATATAAAAGACAGTGAGATGG + Intergenic
989058419 5:37386483-37386505 AAATAAAAAAGTCAGTCAGGTGG - Intronic
989422889 5:41260610-41260632 AAATACAAAAAAAAATTAGGTGG + Intronic
989668401 5:43884563-43884585 AAATCTAAGATAAATTTAGGAGG - Intergenic
989786844 5:45342712-45342734 AAATATAAAAAACTTTTAGTGGG + Intronic
990414747 5:55575422-55575444 AAAAAAAAAATACAGTTTGTGGG + Intergenic
990590976 5:57264487-57264509 AAGTAGAAAACACAGTAAGGTGG - Intronic
991133961 5:63159101-63159123 AAATTTAAAAGACAGGTAGCAGG - Intergenic
991212295 5:64119657-64119679 ATTTAAAAAATACAGCTAGGAGG - Intergenic
991606811 5:68410610-68410632 AAACAAAAAATACAGTGAGCTGG - Intergenic
992422101 5:76616690-76616712 AAATAAAAAATAAAATTAGTTGG + Exonic
992821210 5:80498311-80498333 AAAAAAAAAGGACAGTTAGGTGG - Intronic
993053594 5:82954066-82954088 AAAAATAAAAAAGAGTCAGGCGG + Intergenic
993282623 5:85946074-85946096 AAATAAAAAATAAAGTTAGGTGG + Intergenic
993920881 5:93799905-93799927 CAAGATAATATACAGTTCGGGGG - Intronic
993926194 5:93869333-93869355 AACTGTAAAATACAATTAGATGG - Intronic
994319032 5:98368245-98368267 AGATATAAAATTAAGTAAGGGGG + Intergenic
994581179 5:101644212-101644234 AAATATAAAATAAAATAAGATGG + Intergenic
994983584 5:106906466-106906488 AAATATAAAATTCAGGCAAGTGG - Intergenic
995880876 5:116843559-116843581 AAATACAAAAAACAATTAGCCGG + Intergenic
995901290 5:117070193-117070215 AAATATACAATACAGCCATGTGG + Intergenic
995981794 5:118113172-118113194 AGATATTAAATACTGTTAGTGGG - Intergenic
996488960 5:124069646-124069668 AAATAAAAAAAAGAGTTAAGAGG + Intergenic
996546172 5:124681293-124681315 AAATACAAAAAAAAGTTAGCTGG + Intronic
996720496 5:126625602-126625624 AAAAAAAAAATACAATTAAGAGG + Exonic
998302078 5:141032200-141032222 AAGTTTAAAATTCAGTTAGTAGG - Intergenic
998358037 5:141557939-141557961 AAATACAAAATGGAGTTAGCTGG + Intronic
998414692 5:141937609-141937631 AAATATAAAAAAAAATTAGTTGG + Intronic
998465097 5:142337363-142337385 AAATACAAAAAACAATTAGCCGG + Intergenic
998650369 5:144113034-144113056 AAAGACAAAATACAGTTGTGAGG + Intergenic
998748376 5:145288420-145288442 AAAAGTAAAATACAGTGATGGGG - Intergenic
998915911 5:147011117-147011139 ACATATAAAATACAGTAAAGAGG - Intronic
999209621 5:149876662-149876684 AAATACAAAAAACAATTAGCAGG - Intronic
999864208 5:155683285-155683307 AAATAAAAAATACAATCAAGAGG - Intergenic
1000201008 5:159011119-159011141 AGATGTGAAATAAAGTTAGGCGG - Intronic
1000277909 5:159755363-159755385 AAATTTAACTTACAGTTTGGGGG - Intergenic
1000735128 5:164889740-164889762 AAATATAAAATAAAATTAGCTGG + Intergenic
1000952594 5:167502555-167502577 AAATATAAAAATAAGTTAGAAGG - Intronic
1001440173 5:171736736-171736758 AAAAATAAAGTATAGTTATGAGG + Intergenic
1002391683 5:178918311-178918333 AAATAGAAAATCCAGACAGGTGG + Intronic
1002492669 5:179590190-179590212 AAAAATACAAAACAGTTAGCTGG + Intronic
1002550351 5:179985145-179985167 AAAAAAAAAAAAAAGTTAGGGGG - Intronic
1004352085 6:14898797-14898819 AAATAAAAAATAAAGTGAAGAGG + Intergenic
1004401470 6:15292826-15292848 AAAAATAAAATAAAATTAGCTGG - Intronic
1004447241 6:15711586-15711608 AAAAATAAAAAACAATTAGCTGG - Intergenic
1005151138 6:22752403-22752425 AAATATAAAGTATAGGCAGGTGG + Intergenic
1005431306 6:25760267-25760289 AAAAATAAAATACAGTAAATTGG - Intronic
1005570533 6:27141058-27141080 AAAAACAAAAAACATTTAGGCGG + Intergenic
1005588729 6:27302601-27302623 AAAAAAAAAAAAAAGTTAGGTGG + Intronic
1005663748 6:28027537-28027559 AAATACAAAAAAAAATTAGGTGG - Intergenic
1005780045 6:29181403-29181425 AAAAATAAAATCCAGTTTGAAGG - Intergenic
1006615560 6:35323980-35324002 AAATACAAAAAAAAGTTAGCCGG + Intergenic
1007086521 6:39151173-39151195 AAAAATAAAATACAGTGAAATGG + Intergenic
1007771942 6:44199355-44199377 AAATACAAAAGAAAATTAGGGGG - Intergenic
1007916981 6:45570211-45570233 AAATTTAAAATGCAGTTCGCTGG + Intronic
1008282686 6:49615107-49615129 AAATACAAAAAAAAGTTAGGTGG - Intronic
1008380890 6:50838822-50838844 TAATATGAAATACAGTCAGATGG + Intronic
1008512774 6:52292234-52292256 AAATACAAAAAACAATTAGCCGG + Intergenic
1008717804 6:54310242-54310264 AAAAATAAAATAAAATTAGCTGG - Intronic
1008799596 6:55350192-55350214 TAATATAAAATGCAGTTACCAGG + Intronic
1009832028 6:68950213-68950235 AAATAAAAAATAAAGTTAGTTGG - Intronic
1009857709 6:69285742-69285764 GAATATCAAATATAGTTAGAGGG - Intronic
1010008325 6:71021234-71021256 AGGTATAAAATACAATTAAGAGG + Intergenic
1010052560 6:71524886-71524908 AAATACAACATCCAGGTAGGTGG + Intergenic
1010442933 6:75919121-75919143 AAAAATAAAATAGATTTAGGGGG + Intronic
1010491207 6:76478117-76478139 AAAAATAAAATACAGTTGAAAGG + Intergenic
1010640717 6:78323018-78323040 AGAAATAAAATACAGTAAGAAGG - Intergenic
1010676334 6:78748917-78748939 ATATATAAAATACAATTAAAAGG - Intergenic
1010790829 6:80063096-80063118 AAATAAAAAATAAAGGTGGGAGG - Intergenic
1011088037 6:83564522-83564544 AAAAATAAAATAAAATTAGCCGG - Intronic
1011185568 6:84671900-84671922 GAATAATAAATACAGATAGGAGG + Intergenic
1011423670 6:87202795-87202817 AAGTATTACATACAGTAAGGGGG + Intronic
1011444338 6:87421853-87421875 AAGTAAAAAAATCAGTTAGGTGG + Intronic
1011584185 6:88907061-88907083 AACTTGAAAATACAGTTAGTTGG - Intronic
1011613171 6:89173260-89173282 AAATTTAAAATCTAGTTAGCAGG - Intergenic
1011750947 6:90454241-90454263 AAATACAAAAAAGAGTTAGCCGG - Intergenic
1012132544 6:95515476-95515498 AAATTTATAAAACAGTTAGGAGG - Intergenic
1012534767 6:100282188-100282210 AAATCTAAAATACATTTATTTGG + Intergenic
1012611288 6:101223764-101223786 AAATAAAAAATAAAATTAGCTGG - Intergenic
1013227555 6:108131343-108131365 AAATACAAAATATAGCTGGGCGG + Intronic
1013486694 6:110603529-110603551 AAAAATAAAATAAAATTAGCTGG + Intergenic
1013534479 6:111051441-111051463 AAAAATAAAATAAATTTAAGTGG + Intergenic
1013557612 6:111272497-111272519 AAAAAAAAAATACAGTTAGAAGG - Intergenic
1013665173 6:112340286-112340308 AAATATAAAAAAAAATTAGCCGG - Intergenic
1013698923 6:112738987-112739009 AAAAATAAAATCAAGTTAGCTGG - Intergenic
1013802657 6:113965528-113965550 AAATACAAAAAAAAGTTAGCTGG - Intronic
1013945756 6:115720257-115720279 AAATAGAAAAAACAGAGAGGAGG + Intergenic
1014501154 6:122190923-122190945 AGATAAAAAACAAAGTTAGGAGG + Intergenic
1014736281 6:125099255-125099277 AAATAAAAAATACAGTTCAATGG + Intergenic
1014888857 6:126816836-126816858 AAATATAAAATAAAATTATGTGG - Intergenic
1014937292 6:127399442-127399464 AAATATAAAATATTTTAAGGAGG + Intergenic
1015245982 6:131074987-131075009 AAATATAAAAAACAATTAGCCGG + Intergenic
1015259061 6:131213709-131213731 AAGTATAACAAACAGTTATGTGG + Intronic
1015507619 6:134005867-134005889 AAACATAAAAGACAGAGAGGAGG + Intronic
1016043598 6:139458503-139458525 AAAAAAAAAATACAATTAGCTGG - Intergenic
1016148337 6:140704004-140704026 AAAAATAAAATAAAATTAGCTGG + Intergenic
1016906518 6:149155984-149156006 TAATTTAAAATACAATTAGGAGG - Intergenic
1016972814 6:149780177-149780199 AAAAATAAAAAACATTTAGCTGG + Intronic
1016980960 6:149853667-149853689 AAATACAAAAAACAATTAGCAGG - Intronic
1017160257 6:151359248-151359270 AAAAATAGAATACACTTTGGGGG - Intergenic
1017265074 6:152435323-152435345 AAATATACAAAAAAGTTTGGAGG - Intronic
1017569100 6:155723673-155723695 AAATGTAAAATATAGTAATGTGG + Intergenic
1018313403 6:162533364-162533386 AAATACAAAAAAAAGTTAGCAGG + Intronic
1018347419 6:162915825-162915847 AACTATAAAATAAAGGTAGGAGG - Intronic
1018452047 6:163918435-163918457 AAATATAATAAACAATTATGGGG - Intergenic
1019115635 6:169759579-169759601 AAACATACAAAAAAGTTAGGTGG - Intronic
1019670232 7:2273935-2273957 AAACAAACAATACAGGTAGGTGG + Intronic
1019828801 7:3305227-3305249 AAATTTAAAATACAGTTATCTGG + Intronic
1020115982 7:5476624-5476646 AAATAAAAAAAAAAGTTAGCTGG - Intronic
1020127734 7:5542239-5542261 AAATACAAAAAAAAGTTAGCCGG - Intronic
1020222811 7:6254014-6254036 AAATAAAAAATAAAGAAAGGAGG + Intronic
1020313306 7:6886209-6886231 AAATATAATAAAAAGTTAGCCGG - Intergenic
1020423884 7:8041750-8041772 AAAAATAAAAAACAATTAGCTGG - Intronic
1020652069 7:10888003-10888025 AAATACAAAAAACAATTAGCCGG - Intergenic
1020741807 7:12029493-12029515 AAATCTAAAATAGAGTTTGAAGG - Intergenic
1020921773 7:14274288-14274310 AAAAATAAAATAAAATTTGGAGG - Intronic
1021022111 7:15614249-15614271 TAAAATAAAATAAAATTAGGTGG + Intronic
1021062702 7:16133153-16133175 AAAAATAAAAAAAAGTTAGTTGG + Intronic
1021192269 7:17634563-17634585 CATTATAAAATACAGTATGGAGG - Intergenic
1021248068 7:18289286-18289308 AATTATAAAAGAGACTTAGGAGG + Intronic
1021259843 7:18441927-18441949 AAATACAAAAAAAAGTTAGCCGG - Intronic
1021263141 7:18484044-18484066 ATATTTAAAATACTGTTATGGGG + Intronic
1021397734 7:20171411-20171433 AAATATAAAAAAAAATTAGCTGG - Intronic
1021408849 7:20305214-20305236 AAATACAAAAAAAAGTTAGCCGG + Intergenic
1021518908 7:21518904-21518926 AAACATAAAATACATTAAAGTGG - Intergenic
1021547126 7:21826415-21826437 AAATATAAAAGAAAATTAAGGGG + Intronic
1021736131 7:23639730-23639752 AAATGTAATATAAAGTGAGGAGG - Intronic
1023151147 7:37202709-37202731 AAGTATAAATTACAGTAAGAAGG - Intronic
1023482980 7:40654885-40654907 AAATAGACAATACAATTAGAGGG + Intronic
1023579997 7:41671505-41671527 AAATTTAAAATACTGTTCAGAGG + Intergenic
1023621742 7:42080206-42080228 AAATATAAAACACAATTACTGGG + Intronic
1025773627 7:64537766-64537788 AAATACAAAAAACAATTAGCCGG + Intronic
1025874155 7:65464441-65464463 AAATAAAAAATGCAGGAAGGTGG - Intergenic
1026283670 7:68944379-68944401 AAAAATAAAATAAAATTAGCAGG - Intergenic
1026589780 7:71684658-71684680 AAATAAAAAATAAAGTCGGGGGG - Intronic
1027258460 7:76446294-76446316 AAAAATAAAATAAAATTAGCTGG - Intergenic
1027280388 7:76605724-76605746 AAAAATAAAATAAAATTAGCTGG + Intergenic
1027416182 7:77977217-77977239 AAATATAACATAAAATGAGGAGG - Intergenic
1027773229 7:82433024-82433046 AAATATACAAAAAAGTTAGCCGG + Intronic
1027809861 7:82881800-82881822 AAAAATAAAAAAAAATTAGGTGG - Intronic
1027922271 7:84409086-84409108 TAAAAAAAAATACAGTTAGAAGG + Intronic
1028688028 7:93614602-93614624 AACTATAAAAAACAATCAGGTGG + Intronic
1028760306 7:94488476-94488498 AAATACAAAAAAAAGTTAGCTGG - Intergenic
1028967575 7:96819458-96819480 AAAAAAAATATACAGTTATGAGG - Intergenic
1029122822 7:98280066-98280088 AAATATAAAAAAAAATTAGCTGG + Intronic
1029350618 7:100010595-100010617 AAAAATAAAATAAAATTAGCTGG + Intergenic
1029356463 7:100055799-100055821 AAATACAAAAAAAAGTTAGCCGG - Intronic
1029494611 7:100890155-100890177 AAATAGTATATACAGCTAGGGGG + Exonic
1029527342 7:101103075-101103097 AAATACAAAAAAAAGTTAGCTGG + Intergenic
1029805778 7:102994918-102994940 AAATTTAAAATAGAGTCAGGTGG - Intronic
1029940398 7:104474503-104474525 AAATACAAAATAAAATTAGCCGG + Intronic
1029995485 7:105003887-105003909 AAAAATAAAATAAAATTATGTGG + Intergenic
1030026977 7:105334070-105334092 AAAAATAAAATAAAATTAGGTGG - Intronic
1030036714 7:105413831-105413853 AAATAAAAAATAAAATTAGCCGG + Intergenic
1031274195 7:119697340-119697362 AAAAATAAAATAAAATTAGATGG + Intergenic
1031669632 7:124527119-124527141 AGATAGAAAAACCAGTTAGGAGG - Intergenic
1031787721 7:126055879-126055901 AACTATGAAAAACAGTTTGGAGG + Intergenic
1032065440 7:128766117-128766139 AAATAAAAAATAAAATTAGCCGG - Intronic
1032261736 7:130343512-130343534 AAAAATAAAATAAAATTAGCTGG - Intergenic
1032404272 7:131644436-131644458 AAATACAAAAAACAATTAGCTGG + Intergenic
1032425242 7:131817384-131817406 AAAAATAAAATAAAATTAGCTGG + Intergenic
1032703590 7:134403512-134403534 AAATAAAAAATAAAATTAGCTGG + Intergenic
1033080695 7:138294347-138294369 AAAAATAAAAAACAATTAGCTGG - Intergenic
1033189329 7:139262551-139262573 AAATACAAAAAAAAATTAGGTGG + Intronic
1033932210 7:146538054-146538076 AAATATCCAAGCCAGTTAGGAGG + Intronic
1033963739 7:146947744-146947766 AAAAATAAAATAAAATTAGCTGG + Intronic
1034476897 7:151290165-151290187 ACAAATAAAATACAATTATGAGG - Intergenic
1035003492 7:155636931-155636953 AACGACAAAATACAGTTGGGAGG - Intronic
1035963656 8:4166140-4166162 AAATTTAAAATAATGTTATGGGG - Intronic
1036125641 8:6059367-6059389 AAATATAAAAATCAGCTTGGTGG + Intergenic
1037091658 8:14927268-14927290 AAATATAGAAAAAAATTAGGCGG - Intronic
1039164234 8:34659098-34659120 AAATTTAAAGAAAAGTTAGGAGG + Intergenic
1039513318 8:38109092-38109114 AAAAATAAAGCCCAGTTAGGTGG + Intronic
1039535476 8:38308281-38308303 AGAAATAAAGTACAGTAAGGTGG + Intronic
1039555901 8:38474718-38474740 AATAATAAAATTCAGTTAGGGGG - Intergenic
1039729596 8:40259480-40259502 AAATTAAATATAAAGTTAGGGGG + Intergenic
1040043815 8:42941354-42941376 AAATACAAAAAAAAATTAGGTGG + Intronic
1040895495 8:52364204-52364226 AAATAAGAAATACATATAGGAGG - Intronic
1041173505 8:55169685-55169707 AATAATAAAATACAGTTAGATGG - Intronic
1041244231 8:55875636-55875658 AAATATAAAAAAAAATTAGCCGG - Intergenic
1042170244 8:65984293-65984315 AAATAAAAAAAAATGTTAGGAGG + Intergenic
1042257065 8:66816159-66816181 AAATACAAAAAAAAATTAGGTGG - Intronic
1042497720 8:69473454-69473476 AATTCTAAAATAAAGTTAGAAGG + Intronic
1042522001 8:69723411-69723433 AAATAAAAAAAAAAATTAGGTGG - Intronic
1043002500 8:74776751-74776773 AAATTTAAAATGCAGTTAAATGG - Intronic
1043467130 8:80521198-80521220 AAAGATAAATTACAGTTACATGG + Exonic
1043769756 8:84183520-84183542 TAGTATAAAATACAGTATGGCGG - Intronic
1043930207 8:86082115-86082137 AAATACAAAATAAAATTAGCCGG + Intronic
1043966878 8:86488238-86488260 AAATATACAATATAGCTAGAAGG + Intronic
1044012765 8:87015342-87015364 AAATACAAAAAAAAGTTAGCTGG - Intronic
1044077547 8:87841743-87841765 AAATATAAAAAAAAGTTAGCCGG + Intergenic
1044161783 8:88927250-88927272 AAATATAAAGTACATTTATGGGG + Intergenic
1044280413 8:90348377-90348399 AAATACAAAATACAGAAAAGAGG - Intergenic
1044439846 8:92210087-92210109 AAATACAAAAAAAAGTTAGCCGG - Intergenic
1044442590 8:92239219-92239241 AAATATAATATAAATTTATGGGG + Intergenic
1044716436 8:95104022-95104044 AAAAATAAAATAATGTTAAGTGG - Intronic
1044866341 8:96574740-96574762 AAACATAAAATAAAGATAGGAGG - Intronic
1044895348 8:96885828-96885850 AAATACAAAAAAAAGTTAGCCGG + Intronic
1045005241 8:97911718-97911740 AAATAAAAAATAAAGTTATGCGG + Intronic
1045031017 8:98136231-98136253 AAATACAAAAAATAGTTGGGTGG - Intronic
1045148387 8:99373698-99373720 AAATATAAAATAAAAATAGCCGG + Intronic
1045304231 8:100943823-100943845 AAAAATACAATACAATTAGCTGG + Intronic
1046304048 8:112338965-112338987 TTATATACAATACAGTGAGGTGG + Intronic
1046625810 8:116575878-116575900 AAATAAAAAATAAAATTAGCTGG - Intergenic
1046776163 8:118166048-118166070 AAATATAAGATGAAGTTATGAGG - Intergenic
1046787084 8:118279257-118279279 AAATATAAATTACAATCAGGTGG + Intronic
1046817826 8:118604758-118604780 AAAAATAAAAAAAAATTAGGGGG + Intronic
1047827738 8:128595767-128595789 AAAAACAAAAAACTGTTAGGAGG + Intergenic
1047943522 8:129850625-129850647 AAGTATAAAATAGAGTTAGTTGG - Intronic
1049297610 8:141851197-141851219 AAATGCAAAACACAGGTAGGAGG + Intergenic
1050452679 9:5799999-5800021 AAAAATTAAAAACACTTAGGAGG - Intronic
1050737669 9:8782751-8782773 AAATATAAAAATTAGTCAGGTGG - Intronic
1051015616 9:12472009-12472031 AATTAAAAAACAAAGTTAGGAGG + Intergenic
1051319081 9:15880616-15880638 AAAAAAAAAAAACAATTAGGCGG - Intronic
1051325936 9:15968694-15968716 AAATATAAAAATCAGTTGGGCGG - Intronic
1051633196 9:19158908-19158930 AAATACAAAAAACAATTAGCCGG - Intergenic
1051700943 9:19823191-19823213 AAAAATAAAAAACATATAGGGGG - Intergenic
1051821590 9:21176663-21176685 AAATAAAAAATACAATTAATAGG + Intergenic
1051891161 9:21944521-21944543 AAATTTAAAAATCACTTAGGAGG + Intronic
1052400109 9:27989333-27989355 AAATATAAGATACATTCAGATGG + Intronic
1053092940 9:35296398-35296420 AAATATATAAAACAATTATGTGG + Intronic
1053180473 9:35963913-35963935 AAAAATAAAATAAAATTAGCCGG - Intergenic
1053238450 9:36476683-36476705 AAATACAAAAAAAAGTTAGCCGG - Intronic
1053619537 9:39801421-39801443 AAATACAAAAAAAAATTAGGCGG + Intergenic
1053877705 9:42560749-42560771 AAATACAAAAAAAAGTTAGGCGG + Intergenic
1053894952 9:42733617-42733639 AAATAGAAAAAAAAATTAGGCGG - Intergenic
1054233989 9:62540945-62540967 AAATACAAAAAAAAGTTAGGCGG - Intergenic
1054264622 9:62906022-62906044 AAATACAAAAAAAAATTAGGCGG - Intergenic
1055182721 9:73407956-73407978 ATGTTTAAAATACAGTTAGAAGG + Intergenic
1055183946 9:73427481-73427503 AAAAGGAAAATACAGTTAGAGGG - Intergenic
1055190324 9:73512589-73512611 AAATAAAAAATACAGCTAACTGG - Intergenic
1055557285 9:77488184-77488206 AAATTTAAAAAACTGTGAGGAGG + Intronic
1055903196 9:81264453-81264475 AAAAATAAAATAAAATAAGGAGG + Intergenic
1056037593 9:82623681-82623703 AAATGTCAATTACAGCTAGGTGG - Intergenic
1056206789 9:84327086-84327108 TAAGATAAAATAAAATTAGGAGG + Intronic
1057034547 9:91802233-91802255 AAATACAAAAAAAAGTTAGCCGG - Intronic
1057073992 9:92125082-92125104 AATAATAAAATACAATTAGCTGG + Intergenic
1057826113 9:98373090-98373112 AAATATACAAAACAGGGAGGGGG + Intronic
1057841966 9:98493549-98493571 AAATATAAAAATCAGTAAGGTGG - Intronic
1058306331 9:103445675-103445697 AGATAAAAAATACAGTCAGATGG + Intergenic
1058556379 9:106173112-106173134 AAAGATAAAATACAGAGAGGTGG - Intergenic
1059179381 9:112197587-112197609 AAATATAAAAAAAAATTAGCCGG + Intergenic
1059229134 9:112701760-112701782 AAATATAAAATAGGGCCAGGTGG + Intronic
1059526928 9:115000657-115000679 AATTATAAGATCCAGTTAGGGGG - Intergenic
1059747371 9:117216227-117216249 TAATATCAAATACAGTCAGCAGG - Intronic
1059781064 9:117528109-117528131 AAATACAAACTATAGTTATGAGG - Intergenic
1060561320 9:124546396-124546418 AAACATAAGATACTTTTAGGTGG + Intronic
1060698979 9:125734294-125734316 AAAAATAAAAAACAATTAGCTGG + Intergenic
1060850605 9:126872106-126872128 AAATACAAAAAAAAATTAGGCGG - Intronic
1060932778 9:127499211-127499233 AAAAATAAAATAAAATTAGCTGG + Intronic
1061650379 9:132043361-132043383 AAACTCAAAATTCAGTTAGGTGG + Intronic
1061666995 9:132166317-132166339 AAAGATAAAATAAAATCAGGAGG - Intronic
1061988775 9:134146124-134146146 AAATATAAAAAAAAATTAGCCGG - Intronic
1062294571 9:135817551-135817573 AAATACAAAAAAAAGTTAGCTGG - Intronic
1185517690 X:713240-713262 AAATATAAAAAAAAATTAGCCGG + Intergenic
1185525864 X:778243-778265 AAATACAAAAAAAAATTAGGCGG + Intergenic
1185548836 X:967613-967635 AAATATAAAAAAAAATTAGCTGG + Intergenic
1185577717 X:1186802-1186824 AAATATAAAAATCAGCCAGGCGG - Intergenic
1186163153 X:6799413-6799435 ATATTTAAAACACAGTTTGGAGG + Intergenic
1186840665 X:13481733-13481755 AAATAAAAAATACAGTTAGAAGG + Intergenic
1187018457 X:15354128-15354150 AAATATAAAAAAAAATTAGCCGG - Intronic
1187416033 X:19094348-19094370 AAAAAAAAAATAGATTTAGGAGG - Intronic
1187469778 X:19559108-19559130 AAATACAAAAAACATTTAGCTGG + Intronic
1187659680 X:21528504-21528526 ATATTTAAAATACACTTAAGAGG + Intronic
1187684787 X:21805278-21805300 AAAAAAAAAAAAAAGTTAGGAGG + Intergenic
1188153760 X:26714953-26714975 AATGATAAAATAAAATTAGGAGG + Intergenic
1188259922 X:28010473-28010495 ACAGATAACATACATTTAGGTGG + Intergenic
1188405863 X:29808954-29808976 AAATATCAAATCCAGTTAAATGG - Intronic
1188556873 X:31422165-31422187 AAATACAAAAAACATTTAGCCGG - Intronic
1188642407 X:32522655-32522677 AAGTAGAATATACAGTTAAGAGG - Intronic
1188676952 X:32952975-32952997 AAATACAAAAAATAGTTGGGTGG + Intronic
1188879032 X:35469537-35469559 AAATTTAAAAGACATTTAGCAGG + Intergenic
1188942243 X:36254491-36254513 TAATATAAAAAACAGACAGGAGG + Intronic
1189422189 X:40866149-40866171 AAATATGAGAGACATTTAGGAGG - Intergenic
1189586475 X:42467286-42467308 AAATACAAAATACAGAAAGAGGG - Intergenic
1190170933 X:48111074-48111096 AAATATAAAATAAAATTAGTTGG - Intergenic
1190177066 X:48159085-48159107 AAATATAAAATAACATTAGTTGG - Intergenic
1190188799 X:48258350-48258372 AATTATAAAATAAAATTAGTTGG - Intronic
1190203771 X:48385166-48385188 AAATATAAAATAAAATTAGTTGG - Intronic
1190206765 X:48410237-48410259 AAATATAAAATAAAATTAGTTGG + Intronic
1190229003 X:48566981-48567003 AAATACAAAAAAAAATTAGGTGG + Intergenic
1190307169 X:49090980-49091002 AAATACAAAAAAAAGTTAGCTGG - Intronic
1190534859 X:51416370-51416392 AAATTTAAAATACAGCCAAGCGG + Intergenic
1190590719 X:51997422-51997444 CAATATGAAACACAGTTTGGGGG - Intergenic
1190657690 X:52626106-52626128 AAATATAAAATAAAATTAGTTGG - Intergenic
1190794222 X:53725996-53726018 AAATACAAAAAACATTTAGCTGG + Intergenic
1190898787 X:54648511-54648533 AAAAATAAAACACAGTTTGAAGG - Intergenic
1191010917 X:55757978-55758000 AAATATAACATACATTTTTGGGG + Intronic
1192010299 X:67262785-67262807 AACTATAAAGAACAGTTTGGGGG - Intergenic
1192170970 X:68854465-68854487 AAATATAAAGCACGGTTAGCAGG + Intergenic
1192491936 X:71583857-71583879 AAAAAAAAAAAAAAGTTAGGCGG - Intronic
1192986741 X:76407726-76407748 GGATATAAAATTCAGTCAGGAGG + Intergenic
1193097092 X:77562704-77562726 AAAAATTAAATACAATTAGCTGG - Intronic
1193238760 X:79141469-79141491 AAATATAAAATATATTAAAGTGG - Intergenic
1193593055 X:83413189-83413211 TAATAAAAAAAACAGTTTGGGGG + Intergenic
1194332540 X:92600939-92600961 AAATGTGAAATCCAGTGAGGTGG - Intronic
1195262165 X:103143299-103143321 AAAAATAAAAAATAGTTAGCAGG - Intergenic
1195529292 X:105933732-105933754 AAATATAAAGCACAGTGTGGGGG - Intronic
1196037061 X:111157226-111157248 TAATATAAAATGCTGTTTGGGGG - Intronic
1196550598 X:117019108-117019130 AATTATAAAATACAGGTAAAAGG + Intergenic
1196732743 X:118957597-118957619 AAATATAAAAAAAAATTAGCTGG + Intergenic
1197690804 X:129499197-129499219 AAATAAAAAATAAAATTAGCTGG - Intronic
1198086886 X:133290420-133290442 AAATAAAAAAGAGAGTTAGGTGG - Intergenic
1198203864 X:134448016-134448038 AAATACAAAAAACAATTAGCCGG + Intergenic
1198254460 X:134913075-134913097 AAATACAAAATAAAGTTGGCTGG + Intronic
1198284530 X:135176708-135176730 AAATACAAAAAAAAATTAGGTGG - Intergenic
1198366908 X:135950180-135950202 AAACAGATAATACAGTTAGTTGG + Intergenic
1198538657 X:137612633-137612655 AAATACAAAAAAAAATTAGGCGG - Intergenic
1199143803 X:144341035-144341057 AAATAAAAAATACACATATGTGG + Intergenic
1199409563 X:147505010-147505032 AGATAAAAAATAGAGTTAGATGG + Intergenic
1199487575 X:148364942-148364964 AATTATAAAATACAGGTGGCAGG - Intergenic
1200425093 Y:3011663-3011685 ACATATAAACTCCAGCTAGGAGG - Intergenic
1200641241 Y:5719991-5720013 AAATGTGAAATCCAGTGAGGTGG - Intronic
1200840610 Y:7777318-7777340 AAATACAAAATAAAATTAGCCGG - Intergenic
1201184355 Y:11384695-11384717 AAAAAGATAATATAGTTAGGTGG + Intergenic
1201243120 Y:11977798-11977820 GAATGTAAAGTTCAGTTAGGAGG - Intergenic
1201382245 Y:13394596-13394618 AACTATAAAATACAAATAGTTGG - Intronic
1201416830 Y:13755363-13755385 AAAAATATAATACATGTAGGAGG + Intergenic
1201534787 Y:15034508-15034530 AAAAATAAAAAACAATTAGCTGG + Intergenic
1201618074 Y:15923957-15923979 AAATACAAAAAAAAGTTAGCCGG - Intergenic
1201652479 Y:16305188-16305210 AAAAATAAAATAAAATTAGCTGG + Intergenic
1201701644 Y:16888617-16888639 GAAAAGAAAATACAGTTTGGAGG - Intergenic
1202049976 Y:20770411-20770433 ATATTTCAAATAGAGTTAGGTGG - Intronic