ID: 972437325

View in Genome Browser
Species Human (GRCh38)
Location 4:39045862-39045884
Sequence TCTTCCAGAGGTTAGATGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 174}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972437323_972437325 0 Left 972437323 4:39045839-39045861 CCAATATTCTGTTTCTGGTGTCT 0: 1
1: 0
2: 6
3: 33
4: 313
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437319_972437325 5 Left 972437319 4:39045834-39045856 CCCTCCCAATATTCTGTTTCTGG 0: 1
1: 0
2: 0
3: 19
4: 287
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437314_972437325 17 Left 972437314 4:39045822-39045844 CCCACCCCTGCACCCTCCCAATA 0: 1
1: 0
2: 2
3: 49
4: 507
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437315_972437325 16 Left 972437315 4:39045823-39045845 CCACCCCTGCACCCTCCCAATAT 0: 1
1: 0
2: 1
3: 39
4: 611
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437317_972437325 12 Left 972437317 4:39045827-39045849 CCCTGCACCCTCCCAATATTCTG 0: 1
1: 0
2: 0
3: 19
4: 279
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437318_972437325 11 Left 972437318 4:39045828-39045850 CCTGCACCCTCCCAATATTCTGT 0: 1
1: 0
2: 0
3: 9
4: 199
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437312_972437325 21 Left 972437312 4:39045818-39045840 CCCACCCACCCCTGCACCCTCCC 0: 1
1: 1
2: 16
3: 320
4: 2396
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437316_972437325 13 Left 972437316 4:39045826-39045848 CCCCTGCACCCTCCCAATATTCT 0: 1
1: 0
2: 3
3: 171
4: 2051
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437311_972437325 22 Left 972437311 4:39045817-39045839 CCCCACCCACCCCTGCACCCTCC 0: 1
1: 4
2: 30
3: 287
4: 2253
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437321_972437325 4 Left 972437321 4:39045835-39045857 CCTCCCAATATTCTGTTTCTGGT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437322_972437325 1 Left 972437322 4:39045838-39045860 CCCAATATTCTGTTTCTGGTGTC 0: 1
1: 0
2: 1
3: 21
4: 250
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174
972437313_972437325 20 Left 972437313 4:39045819-39045841 CCACCCACCCCTGCACCCTCCCA 0: 1
1: 2
2: 22
3: 450
4: 3402
Right 972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972437325 Original CRISPR TCTTCCAGAGGTTAGATGTG CGG Intronic
903411186 1:23144671-23144693 TCTTCCTGCTGTTAGATGGGAGG - Intronic
904200154 1:28814311-28814333 TCTTCCACAGGGTTGTTGTGAGG + Intronic
904972980 1:34433624-34433646 TCTCCCAGAGGTTCCCTGTGGGG - Intergenic
905473626 1:38210607-38210629 TCTTCCAGAGGCCAGATGTTCGG - Intergenic
905914120 1:41673254-41673276 TCTCCCAGAGGCCAGATGGGTGG + Intronic
909770040 1:79410583-79410605 TCTTACAGAGGTCATATGTGAGG - Intergenic
912107721 1:106301774-106301796 TTTGCCAGAGGTTAAATGGGAGG - Intergenic
912861555 1:113218246-113218268 TATTCCAGAGCTTAGCTGAGAGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914916918 1:151824637-151824659 TCTCCCAGAGGTTAGAAGGAAGG - Intronic
916530418 1:165651446-165651468 ACTTCCATTTGTTAGATGTGAGG + Intronic
916570304 1:166019681-166019703 TCCTCCAGAGGTTTCATCTGGGG + Intergenic
916611245 1:166393952-166393974 TCATCCTAAGGTCAGATGTGAGG - Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
920696374 1:208184181-208184203 TGGCCCAGAGGATAGATGTGGGG + Intronic
920836547 1:209516121-209516143 TCTCCCAGAAGTGAGCTGTGTGG - Intergenic
921678758 1:218007139-218007161 TCTTCTACAGGTTCGATCTGTGG - Intergenic
921848018 1:219904693-219904715 TCTTCCACATTTTATATGTGAGG - Intronic
1062765395 10:58997-59019 TCTTCCAGAGTTTAGAGGAAAGG + Intergenic
1063915711 10:10879929-10879951 TACTCAAGAGGTTAGATGTCAGG - Intergenic
1064348178 10:14551962-14551984 TCTCCGAGAGGCTAAATGTGTGG - Intronic
1064969222 10:21047135-21047157 TCTCCCATAGTTTAAATGTGTGG - Intronic
1067016264 10:42758083-42758105 TCTGCCAGAGGTTTGAAGTCAGG + Intergenic
1070242032 10:74691845-74691867 ACATCCTGAGGTTATATGTGTGG + Intronic
1070370659 10:75779007-75779029 TATTCCAGAGGCTAGCTGGGAGG - Intronic
1073023670 10:100469752-100469774 TGTTCTACAGGTCAGATGTGTGG + Intronic
1077980177 11:7292196-7292218 TGTTCCACAGGGTAGATGAGAGG + Intronic
1078116581 11:8458485-8458507 GTTTCTAGAGGGTAGATGTGAGG + Intronic
1080040908 11:27758536-27758558 ACTTCCAGTGGTTATATCTGTGG - Intergenic
1080291172 11:30673337-30673359 TCTTCCAGAGTGCAGAAGTGTGG + Intergenic
1082696562 11:56373355-56373377 TCTTCTAGATGTTAGATGATGGG - Intergenic
1085671217 11:78466110-78466132 TCTTCCTGAGGCTCCATGTGTGG + Intronic
1086235947 11:84630328-84630350 TCATCCTGAGGTTAGGTTTGGGG + Intronic
1087465477 11:98499034-98499056 TCTTCCAGAGGACAAATGTCTGG + Intergenic
1087590394 11:100180012-100180034 TCTTCCAGAGATTTGAGGTGGGG + Intronic
1088793866 11:113250434-113250456 ACATCCAGAGGTTAGAAATGTGG - Intronic
1093557672 12:20496219-20496241 TATTCCATATGTTTGATGTGTGG + Intronic
1093961450 12:25277304-25277326 TCCTTCATAGGTTTGATGTGTGG + Intergenic
1094687996 12:32738426-32738448 TCTTCCACAGGTTAGATAAAAGG - Intronic
1095462655 12:42458818-42458840 TATTCCAGGGGTTATGTGTGTGG + Exonic
1095477958 12:42605145-42605167 GCATCCAGAGGGTAGAAGTGGGG - Intergenic
1097684781 12:62681035-62681057 TATTCCATGGGTTTGATGTGGGG + Intronic
1098134010 12:67382311-67382333 TCTTCCAGTGGAGAGATTTGGGG + Intergenic
1099358560 12:81668478-81668500 ACTTCCATGGGTTAGATGTAAGG - Intronic
1099573716 12:84356919-84356941 TCTTCCAGGAGATAGGTGTGCGG + Intergenic
1099581648 12:84455315-84455337 TCTTTGAGTGGTTAGCTGTGAGG + Intergenic
1101391870 12:104308336-104308358 TTTTCCAGAGGTTATATGACAGG + Intronic
1104136803 12:125948241-125948263 TTTTCTCGTGGTTAGATGTGGGG + Intergenic
1112156607 13:96824126-96824148 TCTTCAATAGGTAAGATGAGGGG - Intronic
1113101239 13:106721851-106721873 TCCTCCAGAGGTGAGATATTAGG + Intergenic
1113339364 13:109406926-109406948 TATTCCAGCAGGTAGATGTGAGG - Intergenic
1114068382 14:19086442-19086464 TGTTCCAGAGCTTAGAGGAGAGG + Intergenic
1114093883 14:19313572-19313594 TGTTCCAGAGCTTAGAGGAGAGG - Intergenic
1116566663 14:46453655-46453677 TCTACCAGAGCTTGTATGTGAGG + Intergenic
1117912755 14:60650018-60650040 TCTTCCAGAGGCTGCATGCGCGG - Intronic
1118905743 14:70021971-70021993 ACTACCAGAGGTCAGAAGTGGGG - Intronic
1119670038 14:76511392-76511414 TCTTCCAGAGGCTACATCTTTGG + Intergenic
1120477296 14:85004645-85004667 TCTTCCAGAGGCTAGAAGTCCGG - Intergenic
1120746603 14:88158154-88158176 TCTTCCAGAGGCAAGACGGGTGG + Intergenic
1121302275 14:92881213-92881235 TTGTCCAGTGGTTAGGTGTGTGG + Intergenic
1202919140 14_KI270723v1_random:14710-14732 TCTTCCAGATGTTAGGTGCAGGG - Intergenic
1202925490 14_KI270724v1_random:20285-20307 TCTTCCAGATGTTAGGTGCAGGG + Intergenic
1126216573 15:46162037-46162059 TCTTCCAGATCTTAGATGAAAGG - Intergenic
1126328264 15:47505107-47505129 CCTTCCGGAAGTTAGATCTGTGG + Intronic
1133257234 16:4524590-4524612 TCTTCCAGGTGGTAGATGGGAGG - Intronic
1133313555 16:4867542-4867564 TGGTCCAGAGCTTAGATGAGAGG + Intronic
1137037462 16:35578616-35578638 TCTGACAGAGGTGAGAGGTGCGG + Intergenic
1138572916 16:57887267-57887289 TGTTGCAGAGGTTAGAGGAGAGG - Intronic
1140538493 16:75733190-75733212 TATTCCAGAGCTTAGCTGAGGGG - Intronic
1141712000 16:85705143-85705165 TCCTTGAGGGGTTAGATGTGGGG - Intronic
1144756813 17:17684819-17684841 TCTTGGAGAGGTTGGTTGTGTGG + Intronic
1146287783 17:31585857-31585879 TGAACCAGAGGATAGATGTGTGG + Intergenic
1146546978 17:33748403-33748425 TCTTGCAGAGGCTAAATCTGAGG - Intronic
1146608740 17:34286029-34286051 TCTTCCAGTGACTGGATGTGAGG - Intronic
1148100606 17:45088286-45088308 TCATTCAGAGGTGAGATGTGTGG - Intronic
1148509517 17:48156755-48156777 TGTTTCAGAGTTTGGATGTGTGG + Intronic
1150001454 17:61443344-61443366 TCTCCCAGAGCTGAGGTGTGGGG - Intergenic
1150498382 17:65626670-65626692 TTTGCCAGATGTTAGATATGTGG + Intronic
1151596729 17:75082523-75082545 CCTTCCAGAGGTTGGAGGTTGGG + Intergenic
1152048102 17:77951879-77951901 CCTTCCACAGTTTAGATATGTGG + Intergenic
1152706627 17:81846872-81846894 TCTTCCCGAGGTGACAAGTGTGG - Intronic
1155652992 18:28162856-28162878 TATTGCAGAGGATTGATGTGAGG + Intronic
1160282316 18:77502830-77502852 TCTTCACAAGGTGAGATGTGGGG + Intergenic
1160455967 18:79000692-79000714 ACTTCCAGAGGTAAGATCAGAGG + Intronic
1163724209 19:18913332-18913354 ATGTCCAGAGGTTAGAGGTGCGG - Intronic
1167579265 19:50332339-50332361 TTTTGCAGAGGTCAGAAGTGTGG + Intronic
1168485981 19:56762317-56762339 TCATCAAGAGATCAGATGTGAGG - Intergenic
925505056 2:4553377-4553399 TCTTGCCGAAGTGAGATGTGTGG + Intergenic
927202552 2:20587458-20587480 TGTTTCAGAGGGTAGAGGTGAGG + Intronic
930958743 2:57233426-57233448 TCTTCAGGAGGGTAAATGTGAGG - Intergenic
932902641 2:75716909-75716931 TGTTCCAAAGGTCAGGTGTGAGG + Intergenic
933366108 2:81356310-81356332 TCTCCCAGAGCTAAGCTGTGTGG + Intergenic
938137046 2:128767991-128768013 TCTGCCAGAGGTGAGAAGTTAGG + Intergenic
938944658 2:136201025-136201047 TCTTCCAGAGCTTAGAGGAAAGG + Intergenic
940508090 2:154581271-154581293 TCTTCCAGAAAATAGAAGTGGGG + Intergenic
941509166 2:166384377-166384399 TCTTCCATATATTAGCTGTGTGG - Intergenic
941906779 2:170724116-170724138 GCTTACAGATGTTAGATTTGAGG - Intergenic
946779144 2:223175126-223175148 TTTTCCAGAGGTCAGATAAGAGG - Intronic
946989111 2:225308079-225308101 TCTTTCAGAGGTTGGATTGGGGG + Intergenic
947251193 2:228106261-228106283 ACTTCTAGTGTTTAGATGTGTGG - Intronic
948871265 2:240799396-240799418 TCTTCCAGAGGCTACAGGGGAGG + Intronic
1169620384 20:7500013-7500035 AGTTCCAGAGATTAGCTGTGAGG + Intergenic
1171777588 20:29383639-29383661 TCTTCCAGATTTTAGATGAAAGG + Intergenic
1172326625 20:34040789-34040811 TCTTTCAGAGACTAGATATGTGG - Intronic
1172347190 20:34210758-34210780 TGTTCCAGATGTTAGATGAAAGG + Intronic
1173073916 20:39797895-39797917 TCTGCCAGAGGATTAATGTGTGG - Intergenic
1173570829 20:44075025-44075047 TCTTGCAGGGGTCAGAGGTGTGG + Intergenic
1174560291 20:51426045-51426067 TCTTCCATGGGATAGATGAGTGG - Intronic
1178257161 21:31064646-31064668 TCTTCCAGAAGGATGATGTGAGG + Intergenic
1178468660 21:32871866-32871888 TGTGCCAGAGGGTGGATGTGGGG + Intergenic
1180486853 22:15809003-15809025 TGTTCCAGAGCTTAGAGGAGAGG + Intergenic
1183811103 22:40258149-40258171 TCTTCCAGAGGAAAGGTTTGTGG - Intronic
952083593 3:29791025-29791047 TCTATCAGAGCTGAGATGTGAGG - Intronic
956720602 3:72114224-72114246 TCTTCTATAGGTTAGATGCCAGG + Intergenic
957082380 3:75647572-75647594 TCTTCCAGATGTTAGGTGCAGGG + Intergenic
957237681 3:77615502-77615524 GTTTCCAGAGGCTAGATGAGAGG - Intronic
959584745 3:108015527-108015549 TATTCCAGAGCTTAGCAGTGGGG - Intergenic
961622800 3:128238108-128238130 TCTTCCAGGGGATAGTGGTGAGG + Intronic
961854768 3:129858732-129858754 GCTTGCAGATGTTAAATGTGAGG - Intronic
964582128 3:158251888-158251910 TCTTCCAGATGTTAGAGGAAAGG + Intronic
969004471 4:4008231-4008253 TCTTCAAGAGGTTAGAGAGGTGG - Intergenic
969748395 4:9091917-9091939 TCTTCAAGAGGTTAGAGAAGTGG + Intergenic
969859713 4:10026086-10026108 TCTTCGAAAGGTTTGCTGTGAGG + Intronic
970294030 4:14608752-14608774 ACTGCCACAAGTTAGATGTGTGG - Intergenic
972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG + Intronic
973932297 4:55805353-55805375 TCATCCATAGGCAAGATGTGTGG + Intergenic
974877987 4:67721005-67721027 TCTTCCAGAGGATAGTGGGGTGG + Intergenic
976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG + Intronic
977020635 4:91754881-91754903 TCTTCCAGAGGTTTGATGTAGGG - Intergenic
977593246 4:98849847-98849869 TCTTCCAGAGAATAGATAAGAGG - Intergenic
977812495 4:101373504-101373526 TGTTCCAGAGGTTAGAGGAAAGG + Intergenic
979719506 4:123882488-123882510 TCTTCTATAGGTTAGAAGTCTGG - Intergenic
980866092 4:138554836-138554858 TCTCTCAGAGGGTAGATGTGAGG + Intergenic
985928489 5:3036030-3036052 TCTTCCTGGGGTTGGATGAGGGG - Intergenic
986316467 5:6592000-6592022 TCAACCAGCCGTTAGATGTGGGG - Intergenic
986475694 5:8129348-8129370 ATTTCCAAAGGTTAGATGTGAGG + Intergenic
986559664 5:9047938-9047960 TCTTCCACAGGGTAACTGTGAGG + Intronic
987948516 5:24646961-24646983 TTTTCTAGAAGGTAGATGTGTGG - Intergenic
987950868 5:24674131-24674153 CCTTCCAGAACTTAGATTTGGGG - Intergenic
989492090 5:42069343-42069365 TCTTCCAGATTTTAGATGAAAGG + Intergenic
994398436 5:99248438-99248460 TCTGCCAGAAGTGAGATGAGGGG + Intergenic
995397044 5:111698101-111698123 TCTTCCTGAGACTGGATGTGGGG - Intronic
998583352 5:143403198-143403220 TCTGCCAGAGGTAAGAAGCGAGG - Exonic
999683429 5:154081276-154081298 TTTTCCTGAGGCTACATGTGAGG - Intronic
1001019008 5:168166947-168166969 GCTTCCTGAGGTTACATGAGTGG - Intronic
1003563395 6:7202439-7202461 TCCTACAGAGCTTAGGTGTGGGG + Intronic
1004615619 6:17285794-17285816 CCTTTCAGAGGTTATATGGGTGG + Intronic
1006955457 6:37866295-37866317 TCTTCCTGAAATTAGATTTGAGG + Intronic
1009922965 6:70085719-70085741 TTTTCAAGAGGTTAGATATATGG - Intronic
1011631396 6:89328897-89328919 TCTTCCAGAAGTTAAATGGGGGG - Exonic
1012099480 6:95012587-95012609 GTTACCAGAGGCTAGATGTGGGG - Intergenic
1013314279 6:108926086-108926108 CTTGCCAGAGCTTAGATGTGGGG + Intronic
1017790168 6:157790798-157790820 TCTTCCAGAAGTTGGGTGTAGGG + Intronic
1020088418 7:5323907-5323929 GCTTTCTGAGGTTAGATGTGGGG - Intronic
1020757886 7:12226560-12226582 TCTTGCAGAGGTTAATGGTGTGG + Intronic
1022214485 7:28244794-28244816 TCATCCACAGGTTTGAAGTGAGG - Intergenic
1022414838 7:30168975-30168997 TCTTCCACAGTTTAGAGGTATGG - Intergenic
1023526303 7:41107282-41107304 TCTTCCAGAGGATTGTTGTGAGG + Intergenic
1025205894 7:56993205-56993227 GCTCTCTGAGGTTAGATGTGGGG + Intergenic
1025206589 7:56996617-56996639 TCCTCCAGACAGTAGATGTGGGG - Intergenic
1025666046 7:63583733-63583755 GCTCTCTGAGGTTAGATGTGGGG - Intergenic
1029292963 7:99516683-99516705 GCTTCCAGAGGTGAGATGTCCGG + Intronic
1032477367 7:132221354-132221376 TCTGGCAGAGGTTCTATGTGCGG - Intronic
1035402260 7:158574570-158574592 CCTTCCTAAGGTTAGATGTGGGG + Intronic
1036742834 8:11380626-11380648 TCTTCCAGATGTTATATAGGTGG + Intergenic
1041887514 8:62828234-62828256 TTTGCCAGAGGTTATAGGTGGGG + Intronic
1045119015 8:99015125-99015147 TCTTCCCAAGGTTAGTTGAGTGG + Intronic
1046244693 8:111543692-111543714 TCTGCTAGAGGTTAGATCTTAGG - Intergenic
1046724872 8:117663351-117663373 TCTTCCAGTGGACAGAAGTGAGG + Intergenic
1047622872 8:126626043-126626065 TCTTCCAGGGCTGAGAAGTGAGG - Intergenic
1048209350 8:132442068-132442090 TCTTTCAGAGGGTGGAGGTGGGG + Intronic
1051501210 9:17779630-17779652 TCTTCCAGTGGTTTTATATGTGG - Intronic
1052384358 9:27806839-27806861 ACTGCCAGAGGTTAGGGGTGGGG + Intergenic
1053678163 9:40459832-40459854 GCTTCCAGAGGTGAGAGGAGAGG - Intergenic
1059708733 9:116847911-116847933 TCATACAGTGATTAGATGTGGGG + Intronic
1060055757 9:120411667-120411689 TCTCCCTTAGGTAAGATGTGGGG - Intronic
1062739854 9:138165260-138165282 TCTTCCAGAGTTTAGAGGAAAGG - Intergenic
1193151453 X:78128853-78128875 TCTTCCAGAGGTTGCTTCTGGGG - Exonic
1193245357 X:79222021-79222043 TCTTTCAGAGGTTAGACCTTAGG - Intergenic
1194221703 X:91201207-91201229 TATTTCATAGGTTAGATATGAGG - Intergenic
1194877216 X:99204005-99204027 TGTTCCAGAGTTTAGATGAAAGG + Intergenic
1195496098 X:105535759-105535781 ACTGCCAGAGGTTAGGAGTGAGG + Intronic
1196872713 X:120127890-120127912 TATTCCAGAGCTTAGCAGTGGGG + Intergenic
1197414917 X:126164101-126164123 TTTTACACATGTTAGATGTGTGG - Intergenic
1199491115 X:148401891-148401913 TGTTCCAGAGGCTAGAAGTCTGG + Intergenic
1199881470 X:151976773-151976795 TCATCCACAGGATAGCTGTGAGG + Intergenic
1200558221 Y:4664964-4664986 TATTTCATAGGTTAGATATGAGG - Intergenic
1200680060 Y:6199592-6199614 TCTTCCAGATGTTATATAAGAGG + Intergenic