ID: 972439032

View in Genome Browser
Species Human (GRCh38)
Location 4:39067014-39067036
Sequence TCTCACATTAATATGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972439027_972439032 -1 Left 972439027 4:39066992-39067014 CCAGGTTCCCCTGTTATTTATAT 0: 1
1: 0
2: 6
3: 44
4: 344
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data
972439030_972439032 -10 Left 972439030 4:39067001-39067023 CCTGTTATTTATATCTCACATTA 0: 1
1: 1
2: 15
3: 92
4: 549
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data
972439029_972439032 -9 Left 972439029 4:39067000-39067022 CCCTGTTATTTATATCTCACATT 0: 1
1: 2
2: 8
3: 140
4: 1373
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data
972439022_972439032 15 Left 972439022 4:39066976-39066998 CCTATATACCCCATACCCAGGTT 0: 1
1: 3
2: 24
3: 105
4: 418
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data
972439023_972439032 7 Left 972439023 4:39066984-39067006 CCCCATACCCAGGTTCCCCTGTT 0: 1
1: 1
2: 10
3: 62
4: 300
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data
972439026_972439032 0 Left 972439026 4:39066991-39067013 CCCAGGTTCCCCTGTTATTTATA 0: 1
1: 0
2: 0
3: 47
4: 279
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data
972439024_972439032 6 Left 972439024 4:39066985-39067007 CCCATACCCAGGTTCCCCTGTTA 0: 1
1: 1
2: 7
3: 73
4: 274
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data
972439028_972439032 -8 Left 972439028 4:39066999-39067021 CCCCTGTTATTTATATCTCACAT 0: 1
1: 0
2: 7
3: 72
4: 463
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data
972439025_972439032 5 Left 972439025 4:39066986-39067008 CCATACCCAGGTTCCCCTGTTAT 0: 1
1: 1
2: 7
3: 82
4: 327
Right 972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972439032 Original CRISPR TCTCACATTAATATGGTGCA TGG Intronic
No off target data available for this crispr