ID: 972441653

View in Genome Browser
Species Human (GRCh38)
Location 4:39099383-39099405
Sequence GGGGAGATCAATGCATATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972441653_972441657 4 Left 972441653 4:39099383-39099405 CCTCAATATGCATTGATCTCCCC 0: 1
1: 0
2: 1
3: 26
4: 171
Right 972441657 4:39099410-39099432 TTTGAACTCCTAGTACTAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972441653 Original CRISPR GGGGAGATCAATGCATATTG AGG (reversed) Intronic
901117332 1:6857849-6857871 GGGGAGATCTAGGGATGTTGAGG + Intronic
906586653 1:46984456-46984478 TGGGAGATCAATGCAGAATGTGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909334149 1:74451216-74451238 GAGGGGAACAATGCATACTGGGG + Intronic
910977291 1:92920237-92920259 GTGGAGATAAATGAATAATGGGG + Intronic
913327990 1:117644423-117644445 GGGGAGATCAAGGCCTCTAGAGG - Intergenic
914338154 1:146735937-146735959 GGGGAGATCGAGGCAGATTTGGG - Intergenic
914905496 1:151740278-151740300 GGGGAAAGCAATGCTTAGTGGGG + Intergenic
915845386 1:159258622-159258644 GGGGATATCAATGAGCATTGGGG - Intergenic
917089746 1:171341287-171341309 GGGGAAATCAAACCATATTTGGG - Intronic
920624146 1:207579625-207579647 GAGTGGATCAATGCAGATTGAGG - Intronic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
920804895 1:209223703-209223725 GGTGAGGTCAATGCATACAGGGG - Intergenic
921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG + Intergenic
922976485 1:229788451-229788473 GAGTAGATAAATGAATATTGAGG - Intergenic
923247489 1:232146641-232146663 GGGGAGAGCACTGCATTTGGAGG + Intergenic
923330851 1:232923326-232923348 GGGGAGATAATTGAATCTTGGGG - Intergenic
923941391 1:238831362-238831384 TGGGAGATGATTGGATATTGAGG + Intergenic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065485937 10:26236733-26236755 GGGGGGAGCAATACATTTTGTGG - Intronic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1068305772 10:55206017-55206039 TGGGAGATCATTGAATCTTGGGG - Intronic
1069264389 10:66439085-66439107 AGGGAGATCAATGCAGAAGGTGG - Intronic
1071142230 10:82522401-82522423 GTGGAAAACAATACATATTGTGG - Intronic
1073892931 10:108121814-108121836 TGGGAGATAAATGAATAATGAGG + Intergenic
1077439966 11:2563529-2563551 GGGGAAATCAGTGCATGGTGCGG - Intronic
1078567085 11:12425449-12425471 GAGGAGATCAAGGTATTTTGGGG - Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080956076 11:37097497-37097519 GGGCTGATTAATGCATATTCTGG + Intergenic
1080980453 11:37397818-37397840 GGTGAGAAGAATGGATATTGGGG - Intergenic
1081206007 11:40276545-40276567 GGAGAAAGAAATGCATATTGAGG - Intronic
1082573104 11:54766185-54766207 TGTGAGATGAATGCATATTGGGG - Intergenic
1083015128 11:59445181-59445203 GAGGGGAACAATGCACATTGGGG - Intergenic
1086907421 11:92433625-92433647 GGTGAGACCAATGCATAAAGCGG - Intronic
1087394719 11:97583342-97583364 GGTGACATCATTGCATATTTGGG + Intergenic
1088020861 11:105117221-105117243 GAGGAGAACAATACACATTGGGG - Intergenic
1089283144 11:117388364-117388386 ATGGAAATCAATGCATATTCAGG + Intronic
1089418089 11:118309815-118309837 GGGGATATAAATGCAGATTTAGG + Intronic
1089631041 11:119784456-119784478 GGGGAAATCAATGCCCATGGTGG + Intergenic
1090985167 11:131760240-131760262 AGGGTGATTCATGCATATTGCGG + Intronic
1092022897 12:5216859-5216881 GGGGAGAGCTTTGAATATTGTGG - Intergenic
1093979873 12:25464438-25464460 GGGGAGGTCAATCCATCTAGAGG - Intronic
1095832437 12:46601974-46601996 AGGGAGATCAATGCACAAGGTGG - Intergenic
1096920173 12:55075674-55075696 GAGGGGAACAATGCATACTGCGG - Intergenic
1097527521 12:60756261-60756283 AGGGAGATGAATGCATATTCTGG - Intergenic
1098024312 12:66186623-66186645 GTGGGGAACAATGCATACTGGGG - Intergenic
1098829145 12:75338773-75338795 GGGGGGATCAACACACATTGGGG - Intronic
1100014888 12:89997107-89997129 GGGGAAATCATTGCATATAATGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104785327 12:131444875-131444897 GGGGAGCTCACTGCAAGTTGAGG - Intergenic
1104953572 12:132453312-132453334 GGGGAGATCCTGGCATATTGGGG - Intergenic
1105908058 13:24834002-24834024 GGGGAGATCAAAGTTTATTGAGG + Intronic
1106061073 13:26292678-26292700 GAAGAGAAGAATGCATATTGGGG + Intronic
1108976721 13:56453596-56453618 GAGGGGAACAATGCACATTGGGG - Intergenic
1110161995 13:72389482-72389504 TGGGAGATGAATGCATCGTGGGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1111493152 13:89011748-89011770 GGGGAGATAATTGAATAATGAGG + Intergenic
1112565225 13:100546613-100546635 GGTGAGATCATGGCTTATTGTGG - Intronic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1115245297 14:31288211-31288233 GGGAGGATCAATGCATATCTGGG + Intergenic
1116041256 14:39688662-39688684 GGGAAGATCAGTGGATATCGAGG - Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117457861 14:55915634-55915656 GAGGAGTTCAAAGCACATTGTGG - Intergenic
1117496484 14:56310579-56310601 GGGGAGGCCAATGGATATGGAGG - Intergenic
1120246960 14:82018786-82018808 GGGAAGATCAATACAAATTTTGG - Intergenic
1120375300 14:83696920-83696942 GGTAAGATCAATGTATATTAAGG - Intergenic
1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1126914190 15:53447449-53447471 GAGGTTATCAATGCATTTTGTGG + Intergenic
1127350615 15:58148477-58148499 TGGGAGATCTCTGCATATGGAGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130071947 15:80654921-80654943 GGGGAGATGAAGGCATTTTAAGG - Intergenic
1131397686 15:92099494-92099516 GAGGAGATCAAAGCAAGTTGGGG - Intronic
1133552170 16:6867282-6867304 GGAGAGATCCATCCATATTCTGG + Intronic
1138275451 16:55730882-55730904 AGGGAGTTCAGGGCATATTGTGG + Intergenic
1138515606 16:57534133-57534155 GGGGAGATCAAGGCATTTCCTGG - Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1139996125 16:70981404-70981426 GGGGAGATCGAGGCAGATTTGGG + Exonic
1140338632 16:74135773-74135795 GTGGAGATGAATGAATGTTGGGG + Intergenic
1144367960 17:14562873-14562895 GGGTAGATAAATGCATACTTGGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146299606 17:31677921-31677943 TGGGAGATCAATGCATGGAGAGG - Intergenic
1150993323 17:70286565-70286587 TGGGAGATCACTGAATCTTGGGG + Intergenic
1158648664 18:59268472-59268494 GGGGAGAGGAGTGAATATTGGGG - Exonic
1160905106 19:1448210-1448232 GGGAAGATCAATGCATGCTTGGG - Intronic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1162453865 19:10770807-10770829 TGGGAGATCAATGAATCATGGGG - Intronic
1165881103 19:39044367-39044389 GCTGATCTCAATGCATATTGTGG - Intergenic
1167789396 19:51663724-51663746 GGGGAGCTCCAAGCAGATTGAGG + Intergenic
924967268 2:90610-90632 GGCGAGATCAATGCAGAAGGCGG + Intergenic
926048211 2:9725673-9725695 GGGGAGACCGAGGCATATAGTGG + Intergenic
926199951 2:10787731-10787753 GGGGAAAGCAATGGATACTGAGG + Intronic
930105730 2:47637885-47637907 GAGGAGCTCAATGAATATTTTGG - Intergenic
930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG + Intronic
933231276 2:79810398-79810420 GGGGAGATAAATGAATCATGGGG - Intronic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935541592 2:104354616-104354638 GGGGAGATTACTGCATAAGGAGG + Intergenic
939514038 2:143143937-143143959 GAGGAGAACAATACATATTGGGG - Intronic
944006203 2:194909992-194910014 GAGCAAATCAATGCATCTTGTGG + Intergenic
944827849 2:203503497-203503519 GGGGAGATAATTGAATCTTGGGG - Intronic
947324637 2:228961132-228961154 TGGGAGATCAAGGAATATGGTGG + Intronic
948813541 2:240498377-240498399 GTGGAGATGTATGCAGATTGTGG + Intronic
1170535435 20:17336400-17336422 CAGGAGATCAATGCATCTTAGGG - Intronic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1174510227 20:51045808-51045830 GTGGAGATCATTGAATAATGGGG - Intergenic
1175122028 20:56723177-56723199 GGCGAGATCATTTCATGTTGTGG + Intergenic
1178142164 21:29696723-29696745 GGGGAGACCAAGGCATCTTTAGG + Intronic
1179278874 21:39916916-39916938 GGGGAGAACAATACACACTGGGG + Intronic
1182153527 22:28048121-28048143 GGGTAAATCCATGCATAATGGGG + Intronic
1183447132 22:37864891-37864913 GGGGAAACCAATGCACAGTGTGG - Intronic
1184314357 22:43672656-43672678 GAGGAGAACAATGCACACTGGGG + Intronic
949362201 3:3244030-3244052 GGGGAAATCAATGTAGTTTGGGG - Intergenic
950240291 3:11363614-11363636 GGGGAAATCAAGGCATAGTGAGG + Intronic
951370053 3:21834759-21834781 TGGGAGATGAATGGATCTTGGGG + Intronic
951398115 3:22195992-22196014 GAGGAGAACAATACACATTGGGG + Intronic
956116555 3:65925004-65925026 GGGGAGATCAAAGGATCTTGTGG - Intronic
956733215 3:72215722-72215744 GGGGAAAGCTGTGCATATTGAGG - Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
962005014 3:131339957-131339979 GGCGTGAGCAATGCAAATTGAGG + Intronic
962665945 3:137653955-137653977 AGCGAGATCAATGCAGAATGTGG + Intergenic
962672748 3:137726001-137726023 GGGGAGATCATTGAATCATGGGG - Intergenic
963297610 3:143563188-143563210 GAGGAGATCTATGCTTCTTGGGG + Intronic
963857987 3:150275821-150275843 GGGGAGCTCACTGCTTATTGGGG + Intergenic
963921897 3:150913775-150913797 GGTTAGATCAAGGCAAATTGTGG + Intronic
967411238 3:189168575-189168597 GGGTAGACAGATGCATATTGGGG + Intronic
968299809 3:197603851-197603873 GGGGTGGTGGATGCATATTGAGG - Intergenic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
970552408 4:17195587-17195609 GGGAAAAACAGTGCATATTGTGG + Intergenic
972382499 4:38532361-38532383 AGGGAGATCAATGCATCAGGTGG - Intergenic
972441653 4:39099383-39099405 GGGGAGATCAATGCATATTGAGG - Intronic
975533159 4:75421325-75421347 AGGGAGATCAATGCAGAAGGTGG - Intergenic
979285694 4:118921842-118921864 AGGGAGAGGACTGCATATTGAGG - Intronic
979852147 4:125585766-125585788 GGAGAGAAGAATGAATATTGAGG + Intergenic
981303437 4:143217839-143217861 TGGGAAAACAATGCAAATTGTGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985184341 4:187299400-187299422 GGGGAAATTAATGAATATTGTGG + Intergenic
985701433 5:1375487-1375509 GTAGAGATCAATGCAAATTGAGG - Intergenic
986554271 5:8995383-8995405 TGGGAGATCACTGAATCTTGGGG + Intergenic
987908588 5:24112054-24112076 GGGGAGGTCAGTGCATATGGAGG + Intronic
994334058 5:98543228-98543250 GGGGAGAACAATACATCCTGGGG + Intergenic
995053700 5:107735318-107735340 GGGAAGATCATTACATATTCAGG + Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
999701765 5:154234810-154234832 GGGGAACTCAATACTTATTGGGG - Intronic
1009708497 6:67286993-67287015 GGGGAAAACAATACATACTGGGG + Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1012232332 6:96774871-96774893 GAGGAGATCAACACATACTGGGG + Intergenic
1014565797 6:122946372-122946394 GGGGAGATCATTGCTTCTGGAGG + Intergenic
1015156634 6:130103622-130103644 GGGGAGGCCCATGTATATTGGGG + Intronic
1015206749 6:130649305-130649327 CTGGAGATCAATGCCTTTTGGGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1018493404 6:164321263-164321285 GGGGAGATCGATGCCTTTAGTGG + Intergenic
1024344804 7:48302269-48302291 GCAGAGATCAATGCCAATTGGGG - Intronic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028049727 7:86168080-86168102 TGGGAGATGATTGGATATTGGGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1030173137 7:106625039-106625061 GGGAAGTTAAATGCATATTTAGG + Intergenic
1030324399 7:108204267-108204289 GGGGAGATCAACACACAGTGGGG + Intronic
1031613869 7:123857574-123857596 AGTGAGATCAATGCAGAATGAGG - Intronic
1032764170 7:134975094-134975116 GGGGAGATAATTGAATCTTGGGG + Intergenic
1034785910 7:153925552-153925574 GGGGAGACCACTCCATATGGTGG + Intronic
1039157654 8:34579691-34579713 TGGCAGATCAATGTAAATTGAGG - Intergenic
1040801348 8:51344544-51344566 GGGGTGATTAATTCTTATTGGGG - Intronic
1040973218 8:53160446-53160468 GGGGAGATCATTGAATCATGGGG + Intergenic
1041584058 8:59495484-59495506 AGTGAGATCAATGCAGAATGTGG - Intergenic
1045638128 8:104216593-104216615 GAGGAAACCAAGGCATATTGAGG - Intronic
1046008672 8:108518265-108518287 GAGGAGAACAATGCACATTGAGG - Intergenic
1046096163 8:109563765-109563787 GAGGAGAACAATGCATACTGGGG - Intronic
1048193672 8:132313159-132313181 GGGGAGAATAAAGAATATTGTGG + Intronic
1049453746 8:142676556-142676578 GGGGAGCCCCATGCATCTTGGGG - Intronic
1050214464 9:3306961-3306983 TGGGAGATGACTGCATAATGGGG + Intronic
1051354937 9:16232660-16232682 GGGGAAATAAATGGAAATTGTGG + Intronic
1051771536 9:20584699-20584721 GGGGAGATAATTGAATCTTGGGG - Intronic
1051918457 9:22235412-22235434 GGGGAGAACAACACACATTGGGG + Intergenic
1055343513 9:75310081-75310103 GGGGGGATCAATGCACACTCAGG - Intergenic
1057356278 9:94334209-94334231 GGGCAGATCCATGACTATTGGGG + Intergenic
1057651472 9:96923419-96923441 GGGCAGATCCATGACTATTGGGG - Intronic
1061477948 9:130881583-130881605 GTGGAGATCAATGAATCATGGGG - Intronic
1062146715 9:134993535-134993557 GGGGGGATCCATGCAGACTGGGG + Intergenic
1187491242 X:19753464-19753486 GGGGAGAGATATGCATGTTGGGG - Intronic
1188267764 X:28098509-28098531 GGTGGAATCAAAGCATATTGTGG + Intergenic
1190467149 X:50736429-50736451 GAGGAGAACAACACATATTGGGG - Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1191206629 X:57841827-57841849 AGTGAGATCAATGCAGAATGAGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1194158447 X:90422167-90422189 AGGGAGATCAATGCAGAAGGTGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195493852 X:105506649-105506671 GAGGAGATAAATGCATATAATGG + Intronic
1197052294 X:122074325-122074347 GGGGAGATAATTGAATAATGGGG + Intergenic
1198198515 X:134389748-134389770 GGGGAGATCAATCCAGTTGGAGG - Intronic
1198495595 X:137189254-137189276 GGAGAGATTAATGGATATTTAGG + Intergenic
1199103570 X:143836519-143836541 GAGGAGAACAATGCACACTGGGG + Intergenic
1200422684 Y:2988594-2988616 GAGGAGAACAATACATACTGGGG - Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1200504764 Y:3999135-3999157 AGGGAGATCAATGCAGAAGGTGG + Intergenic