ID: 972445628

View in Genome Browser
Species Human (GRCh38)
Location 4:39140820-39140842
Sequence CATTTGCAATGTCACAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972445628_972445629 15 Left 972445628 4:39140820-39140842 CCATACTTGTGACATTGCAAATG No data
Right 972445629 4:39140858-39140880 TATTTTCCATTTGTTCCTTTTGG No data
972445628_972445631 17 Left 972445628 4:39140820-39140842 CCATACTTGTGACATTGCAAATG No data
Right 972445631 4:39140860-39140882 TTTTCCATTTGTTCCTTTTGGGG No data
972445628_972445630 16 Left 972445628 4:39140820-39140842 CCATACTTGTGACATTGCAAATG No data
Right 972445630 4:39140859-39140881 ATTTTCCATTTGTTCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972445628 Original CRISPR CATTTGCAATGTCACAAGTA TGG (reversed) Intergenic
No off target data available for this crispr