ID: 972445630

View in Genome Browser
Species Human (GRCh38)
Location 4:39140859-39140881
Sequence ATTTTCCATTTGTTCCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972445628_972445630 16 Left 972445628 4:39140820-39140842 CCATACTTGTGACATTGCAAATG No data
Right 972445630 4:39140859-39140881 ATTTTCCATTTGTTCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972445630 Original CRISPR ATTTTCCATTTGTTCCTTTT GGG Intergenic
No off target data available for this crispr