ID: 972447636

View in Genome Browser
Species Human (GRCh38)
Location 4:39161041-39161063
Sequence CTGTGGGAGCTGAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972447636_972447644 8 Left 972447636 4:39161041-39161063 CCTTCCAGCCTCAGCTCCCACAG No data
Right 972447644 4:39161072-39161094 ATTAGAAAAGGCATCAATCATGG No data
972447636_972447645 19 Left 972447636 4:39161041-39161063 CCTTCCAGCCTCAGCTCCCACAG No data
Right 972447645 4:39161083-39161105 CATCAATCATGGAAAATGCCAGG No data
972447636_972447642 -4 Left 972447636 4:39161041-39161063 CCTTCCAGCCTCAGCTCCCACAG No data
Right 972447642 4:39161060-39161082 ACAGGCCTGCATATTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972447636 Original CRISPR CTGTGGGAGCTGAGGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr