ID: 972447787

View in Genome Browser
Species Human (GRCh38)
Location 4:39162565-39162587
Sequence CAGAAAATGAGGCAGTAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972447785_972447787 11 Left 972447785 4:39162531-39162553 CCTAACGAGAAAAAACAGAATAC No data
Right 972447787 4:39162565-39162587 CAGAAAATGAGGCAGTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972447787 Original CRISPR CAGAAAATGAGGCAGTAATC AGG Intergenic
No off target data available for this crispr