ID: 972450844

View in Genome Browser
Species Human (GRCh38)
Location 4:39196819-39196841
Sequence TTGGAGCAGACAAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972450844_972450852 28 Left 972450844 4:39196819-39196841 CCCTCCTCATTTGTCTGCTCCAA 0: 1
1: 0
2: 0
3: 25
4: 311
Right 972450852 4:39196870-39196892 CACTAGGCAAACTCCTGCCTTGG 0: 1
1: 0
2: 2
3: 25
4: 223
972450844_972450850 12 Left 972450844 4:39196819-39196841 CCCTCCTCATTTGTCTGCTCCAA 0: 1
1: 0
2: 0
3: 25
4: 311
Right 972450850 4:39196854-39196876 TGCTGAGCCTCTAACACACTAGG No data
972450844_972450853 29 Left 972450844 4:39196819-39196841 CCCTCCTCATTTGTCTGCTCCAA 0: 1
1: 0
2: 0
3: 25
4: 311
Right 972450853 4:39196871-39196893 ACTAGGCAAACTCCTGCCTTGGG 0: 1
1: 0
2: 4
3: 48
4: 245
972450844_972450854 30 Left 972450844 4:39196819-39196841 CCCTCCTCATTTGTCTGCTCCAA 0: 1
1: 0
2: 0
3: 25
4: 311
Right 972450854 4:39196872-39196894 CTAGGCAAACTCCTGCCTTGGGG 0: 1
1: 0
2: 2
3: 37
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972450844 Original CRISPR TTGGAGCAGACAAATGAGGA GGG (reversed) Intronic
900572716 1:3366705-3366727 TCGGAGCAGAAAAATGATTAGGG + Intronic
901404726 1:9038533-9038555 CTGGAGCAGACAAGCTAGGACGG + Intronic
903801009 1:25968224-25968246 GTTGAGCAGACAGAAGAGGATGG + Intronic
904700604 1:32355756-32355778 TTGGAGGAATCAATTGAGGAAGG + Intronic
904807262 1:33140806-33140828 TTGGAGAGGACAACAGAGGAAGG + Intergenic
905404934 1:37726265-37726287 CTGGACCAGGCAAATCAGGAGGG - Intronic
905821888 1:40999103-40999125 CTGTGGCAGACACATGAGGAAGG + Intronic
907362706 1:53932667-53932689 TTGGAGCTGAGGCATGAGGATGG - Intronic
907518351 1:55007418-55007440 ATGTGGCAGACAAATGAGTATGG + Intronic
909021708 1:70438586-70438608 TTGGACCAGAAAAATGTTGAGGG + Intronic
909503221 1:76358598-76358620 GTGGAGGAGGCAAATGTGGATGG - Intronic
909950081 1:81708709-81708731 TTGAAGCATAAAAATTAGGATGG + Intronic
910224762 1:84925168-84925190 TTGGTGCAGGCATATGAAGATGG + Intergenic
910489540 1:87753493-87753515 TTACAGGAGACAAGTGAGGAAGG + Intergenic
911603368 1:99871469-99871491 TTGTAGGAGACAAATTAGAAAGG + Intronic
912414820 1:109500826-109500848 GTGGAGCAGACAAGCTAGGAAGG + Intronic
912461227 1:109832972-109832994 TGTGACCAGACAAATAAGGAGGG - Intergenic
913575393 1:120168197-120168219 TTGAAGCTGACAAAATAGGAAGG - Intronic
915914413 1:159932404-159932426 GTGGGGCAGACACATGGGGAGGG - Intronic
916209810 1:162351314-162351336 TTGGTACAGTCAAATGAGCAAGG - Intronic
916870147 1:168904713-168904735 CTGGAACAGAAAAATGATGATGG + Intergenic
917666647 1:177231535-177231557 TGGGTGCAGACAAAGGAGCAAGG + Intronic
918514622 1:185349317-185349339 TTGAAGGAGAGAAATGGGGAGGG - Intergenic
918783375 1:188731914-188731936 TTGGGGAAGACTTATGAGGATGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919333777 1:196206061-196206083 TTGTCTCAGACAAATGATGAAGG + Intergenic
920121589 1:203662792-203662814 TTGTAGCAGGAAACTGAGGAGGG + Intronic
920310016 1:205043402-205043424 TTGGAGGAGACAAAAGCGGTTGG - Intronic
920457183 1:206110214-206110236 TTGGAGCTGGCAGATGGGGAAGG - Exonic
921721302 1:218474803-218474825 TTGGAGCAGCAAAATGATTAAGG + Intergenic
921816034 1:219564437-219564459 TTTGAGCAGAGAAATGTTGATGG + Intergenic
921936357 1:220800540-220800562 TGAGTGCAGACAAATGAGAAAGG - Intronic
922249365 1:223833866-223833888 TGGTAGCACACAAATGAGCATGG + Intronic
922300347 1:224293721-224293743 TAAGACCAGACAAATGAGTATGG + Intronic
922507338 1:226134170-226134192 TGGGAGAAGACACATGGGGAAGG - Intergenic
924483108 1:244454137-244454159 TGTGACCAGACAAATAAGGAGGG - Intergenic
924808898 1:247383975-247383997 TGTGACCAGACAAATAAGGAGGG + Intergenic
1064037576 10:11927032-11927054 TTGAAACAGACAAATGAAGAGGG + Intronic
1066088490 10:31994688-31994710 TTGAAGCTGAGAATTGAGGAAGG + Intergenic
1068633139 10:59318862-59318884 TAGGAGCACACTAATGAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071484069 10:86086190-86086212 GTGGAGCAGACAATTGTGGAGGG - Intronic
1073045994 10:100638591-100638613 TTGGAGCAGAGCACTGCGGAGGG + Intergenic
1073867236 10:107818980-107819002 GTGGAGCAGACAGATGGGGCTGG + Intergenic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1074899707 10:117805492-117805514 TTGGTGCAGACGGATGTGGATGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075227741 10:120644881-120644903 TTGCAGGAGATTAATGAGGATGG + Intergenic
1076252722 10:128996606-128996628 TTGCAGCAGACACAGGAGGATGG - Intergenic
1076772875 10:132676681-132676703 TTGGAGCAGAGTCAGGAGGAGGG - Intronic
1076832282 10:133001845-133001867 TGGGAGGTGACAGATGAGGAAGG + Intergenic
1077926603 11:6687524-6687546 TGTGACCAGACAAATAAGGAGGG - Intergenic
1078183700 11:9033412-9033434 TTTGAGCAAATAAATGAAGATGG - Intronic
1078212015 11:9277461-9277483 TTGGATTTGATAAATGAGGATGG - Intergenic
1078298557 11:10101126-10101148 TGTGACCAGACAAATAAGGAGGG - Intronic
1079310084 11:19357586-19357608 TTGGAGGAGTAAAATGGGGATGG + Intronic
1079435801 11:20448049-20448071 TAGGAGGAGACAACTCAGGAAGG - Intronic
1080667110 11:34345542-34345564 TTTGAGGAGACAAATGATGATGG - Intronic
1081358120 11:42138966-42138988 TGGCAGCAGAAAAATTAGGAAGG + Intergenic
1082285177 11:50310297-50310319 TTGCAGCAGCCAATGGAGGAGGG + Intergenic
1084201600 11:67562565-67562587 TAGGAGCAGACAAATGGGGCCGG + Intergenic
1087196291 11:95307472-95307494 TTGGTTTAGGCAAATGAGGATGG + Intergenic
1087700359 11:101430420-101430442 TTGGCACAAACAAATGAGCAGGG - Intergenic
1088998427 11:115026456-115026478 TGGCAGCAGACAAAAGAAGAGGG + Intergenic
1091173609 11:133540487-133540509 TTGGAAGACACAAATGGGGAGGG - Intergenic
1092445479 12:8552423-8552445 TTGGAGGAGACAAAGGAGACAGG + Intergenic
1097591877 12:61584660-61584682 TAGGAACAGACAGATAAGGAGGG - Intergenic
1098932000 12:76428887-76428909 TGGGAGCAGATAAATCAAGATGG + Intronic
1099673261 12:85722297-85722319 GTGTAGTAAACAAATGAGGATGG - Intergenic
1100538867 12:95538815-95538837 TTGGAGGAAAGAAAGGAGGATGG + Intronic
1101072034 12:101086037-101086059 TTTGAGCTGAGAAGTGAGGAAGG + Intronic
1101704334 12:107207363-107207385 GTAGAGCAGAAAGATGAGGAAGG - Intergenic
1102133084 12:110548864-110548886 TTTGAGGAGGCAAAAGAGGAGGG - Intronic
1102943896 12:116968246-116968268 ATGGAGCAGACAAAAGTGGGTGG - Intronic
1103670552 12:122611373-122611395 TTGGAGCAGAGAGAGGAGAAGGG + Intronic
1104793189 12:131496932-131496954 GTGGAGCAGAGAACTGAGAAAGG + Intergenic
1106986909 13:35363954-35363976 TTGGAACTGACAAATGCAGAAGG + Intronic
1107873525 13:44768759-44768781 TTGGAGCTGGGAAAGGAGGAAGG + Intergenic
1108805784 13:54154544-54154566 TTGAACCAGATAAATGATGAGGG - Intergenic
1109965459 13:69687273-69687295 TTGGAGGAGACATCTGAGGTAGG - Intergenic
1110333053 13:74294807-74294829 TTGCAGGGGAAAAATGAGGAAGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111894089 13:94119423-94119445 TTTGAGCAGACAACTGAAGGCGG + Intronic
1112675796 13:101700072-101700094 TTAGAGCTTACAAATGTGGATGG - Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113700956 13:112388049-112388071 TGTGACCAGACAAATAAGGAGGG + Intronic
1114403937 14:22436373-22436395 ATGGCCCAGACAGATGAGGATGG - Intergenic
1114482849 14:23046194-23046216 TTGCAGAACACAAAGGAGGAGGG - Intergenic
1114768306 14:25399928-25399950 GTAGAGCAGAAAACTGAGGAAGG - Intergenic
1115714765 14:36091114-36091136 ATGGAGTAAACAAATGAAGAGGG - Intergenic
1115885866 14:37970961-37970983 TTGGAGCAGTGAGATGAGGAAGG - Intronic
1116389756 14:44378033-44378055 TGGCAGCAGACAAGTGAAGAGGG + Intergenic
1116551956 14:46251574-46251596 TAGGAGCAGACAAGTGAGGGAGG - Intergenic
1119053971 14:71399646-71399668 TGGGAGCAGAGAAGAGAGGATGG - Intronic
1121029741 14:90647853-90647875 ATGGAGCAGACTAATTAGGTGGG + Intronic
1121111143 14:91313936-91313958 TTGGAGCAGGCCAAGGAGAAGGG - Exonic
1121538632 14:94708455-94708477 TTTAAGGAGAGAAATGAGGATGG + Intergenic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1122844790 14:104486976-104486998 CTGGAGCAGAGTAATGAGAATGG - Intronic
1124381619 15:29172486-29172508 TTGGAGCAGGCCAGTGGGGATGG + Intronic
1124994274 15:34707831-34707853 TTTGTGTAGACAATTGAGGAAGG + Intergenic
1128678798 15:69631327-69631349 TGGGAGCAGAGCAAAGAGGAGGG + Intergenic
1129800171 15:78407821-78407843 GTGGTGCTGAGAAATGAGGAAGG - Intergenic
1130837414 15:87664327-87664349 TGTGACCAGACAAATGAGGAGGG - Intergenic
1131321113 15:91392103-91392125 CTGGAGAAGACAAATATGGATGG + Intergenic
1131570471 15:93529999-93530021 TTGGATCACAGAAATGAGGCAGG - Intergenic
1131680791 15:94720840-94720862 TTAGAGAAGGCATATGAGGAAGG - Intergenic
1134264919 16:12684586-12684608 TTGGAGGAAACGAATGAGCAGGG - Intronic
1134278855 16:12800715-12800737 CTGGAGCAGAAAGATGAGGTTGG - Intronic
1135694936 16:24577398-24577420 ATGAAGCAGGCAAAGGAGGAAGG - Intergenic
1136471172 16:30481378-30481400 TTGGAACAGACAAATGGAAAGGG + Intronic
1137400561 16:48150905-48150927 TTGGAGCTTACAAATAAGCAAGG - Intronic
1140861254 16:79020151-79020173 TTGAAACAGTCAAAGGAGGAAGG + Intronic
1141046378 16:80719506-80719528 TTAGTGCACACAAATGACGAGGG - Intronic
1143205056 17:5135546-5135568 TTGGAGCAGCCCCAGGAGGAGGG - Intronic
1143475914 17:7203892-7203914 TTGGAGCAGCCAGAGGAGGAAGG + Intronic
1143552954 17:7642483-7642505 TTGGAGGAGAGAACGGAGGAGGG - Intergenic
1143711339 17:8737581-8737603 TTCTAGCAAATAAATGAGGAAGG + Intronic
1144262491 17:13536130-13536152 TGGGAGATGACAAATGAGAATGG - Intronic
1144445730 17:15326356-15326378 ATGAAGCTGAGAAATGAGGAGGG + Intronic
1144771533 17:17762272-17762294 TTGGAGAAGACCCAGGAGGATGG + Intronic
1145053376 17:19681462-19681484 CTGGAGGAGACAAGTGATGATGG + Intronic
1145994437 17:29097359-29097381 TTGAGGCAGACAAGGGAGGATGG + Intronic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148388584 17:47254009-47254031 TTGGAGCCGGCAAACGCGGAGGG + Intronic
1148628663 17:49089889-49089911 CTGGAGAAGACATATGTGGATGG + Intergenic
1150273747 17:63882800-63882822 GAGGAGGAGACAAAAGAGGAGGG - Intergenic
1153451376 18:5233286-5233308 ATGGACCAGGCAACTGAGGATGG + Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1158246814 18:55441150-55441172 TTGGAGCACACATATGAGTTGGG - Intronic
1158370350 18:56794976-56794998 TTCTAGCTAACAAATGAGGAAGG - Intronic
1158585743 18:58732723-58732745 ATGGAGGAGACAAATGAGTCAGG + Intronic
1159332986 18:67025293-67025315 TGGGAGCAGCCAAGGGAGGAGGG + Intergenic
1159402322 18:67954471-67954493 TTGGAGAAGACAAAAGGGGATGG + Intergenic
1159777538 18:72620618-72620640 TTGGAGCAGAAAAACAGGGATGG + Intronic
1160193229 18:76732489-76732511 TGTGACCAGACAAATAAGGAGGG + Intergenic
1161836284 19:6649305-6649327 GTGGAGGAGACAGAAGAGGAAGG - Intergenic
1162270245 19:9608591-9608613 TTGAAACTGACAAATGAGGCTGG + Exonic
1162418415 19:10552182-10552204 CTGGGGCAGACAGACGAGGAAGG - Intronic
1162790242 19:13058998-13059020 TGAGAGGAGGCAAATGAGGATGG - Intronic
1164436444 19:28234276-28234298 TTGGAACAAATAAATGAGGAAGG + Intergenic
1164519205 19:28964981-28965003 TTCCAGCTGACAAATGAAGAAGG + Intergenic
1165545229 19:36529496-36529518 TTGGAGGACAGAAATGAGAAGGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165791294 19:38494269-38494291 TTGGACCAGAACAATGTGGAAGG - Intronic
1166371763 19:42305719-42305741 TTCTAGCAACCAAATGAGGAAGG + Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167153961 19:47726783-47726805 TTGGGGCAGGCTAAGGAGGAAGG - Intronic
1167643198 19:50693249-50693271 TCGGAGCAGAGAAATGGGGTGGG - Intronic
925237909 2:2295224-2295246 TGGGAAGAGACAGATGAGGAAGG + Intronic
925394680 2:3524688-3524710 TTGGATCACATAAATGAGAAGGG + Intergenic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
928385481 2:30863942-30863964 ATGGAGCAGAAATATGAGGCAGG + Intergenic
928792392 2:34973316-34973338 TTTGAGCAGGAAAATGAGTAAGG - Intergenic
929960656 2:46493922-46493944 TGGGAGCAGGAAAATGAGGCGGG + Intronic
930346209 2:50185044-50185066 TTGGAGGAGACATATGTGAAAGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
932126988 2:69153450-69153472 TTGCAGCAGACAAGTATGGAAGG + Intronic
932564301 2:72895952-72895974 TTGGAGCTGACAGATGTGCAAGG - Intergenic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
936033670 2:109092191-109092213 TGTGACCAGACAAATTAGGAGGG - Intergenic
936082210 2:109440031-109440053 TCTGAGCAGACAAAAGAGAAAGG + Intronic
937336340 2:121064582-121064604 TTGGGGGAGACTAATGAGGTTGG + Intergenic
937355596 2:121196315-121196337 TTGGAGCAGCCAAGAGAGGCAGG + Intergenic
937677013 2:124602452-124602474 TTGCATCAAACAAGTGAGGAGGG - Intronic
938700851 2:133878028-133878050 TGTGATCAGACAAATAAGGAGGG + Intergenic
939164787 2:138628763-138628785 TTTGGGAAGACAAATGAGAAGGG - Intergenic
940397483 2:153207519-153207541 TTGTAGCTGATAAATGAAGAAGG - Intergenic
940400287 2:153241166-153241188 TGTGATCAGACAAATAAGGAGGG - Intergenic
940826431 2:158417439-158417461 TTGGAGCCAACAAATAAGCATGG + Intronic
941108317 2:161388530-161388552 TTGCAGAAGGCAAAAGAGGAAGG - Intronic
941465004 2:165815070-165815092 TTGGGGCAGACAGAGGAGGATGG - Intergenic
942350253 2:175045195-175045217 TGGGAGGAGAGAAAGGAGGAGGG - Intergenic
943758615 2:191584917-191584939 TGTGACCAGACAAATAAGGAGGG - Intergenic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
945725765 2:213470872-213470894 TTGGGGCAGAGATATGTGGATGG - Intronic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
946812995 2:223546357-223546379 TTGAAACAGTCAAATGAAGAAGG + Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947849292 2:233272216-233272238 GTGGCCCAGAAAAATGAGGAAGG + Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948295682 2:236858557-236858579 TTGGTGAAGACAAAAGGGGAGGG + Intergenic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1170045019 20:12075757-12075779 TTGAAGAAGACAGATGAGAAGGG - Intergenic
1172324900 20:34026735-34026757 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1173137415 20:40451484-40451506 TTGGAGCATACCAGAGAGGAGGG - Intergenic
1173238220 20:41267711-41267733 TTGGAGCAGAAACCTGAAGAAGG + Intronic
1173252816 20:41373675-41373697 GTGGAGCAGACACACGAGGTGGG + Intergenic
1173498441 20:43535375-43535397 TTGCAGCAGGGAAATAAGGAAGG - Intronic
1174279592 20:49429483-49429505 GGGGAACATACAAATGAGGAAGG + Intronic
1174983160 20:55420178-55420200 TTAGAGGAGAAAAATGAGCAAGG - Intergenic
1175100515 20:56575741-56575763 TGGGAGCAAACCAATGTGGAAGG - Intergenic
1176049220 20:63107847-63107869 GTGGGGCAGAGAACTGAGGAGGG + Intergenic
1176106367 20:63391320-63391342 TTCGAACAGACATATAAGGAAGG + Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177714448 21:24821200-24821222 TTTGAGCAGACAAATAAGAAAGG - Intergenic
1177825440 21:26077650-26077672 TTGGAGGAGACGAACGAGGCTGG - Intronic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178701625 21:34838392-34838414 TCTTAGCAGAAAAATGAGGAAGG + Intronic
1178767156 21:35465263-35465285 TTAGTGCACACAAATGAGTATGG - Intronic
1179288490 21:39997993-39998015 TGGCAGCAGACAATGGAGGAGGG - Intergenic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181866735 22:25864004-25864026 TGGCAGGAAACAAATGAGGAAGG - Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1185237570 22:49723783-49723805 ATGGGGCTGACAAAGGAGGATGG + Intergenic
949221648 3:1641725-1641747 TTGTATAAGACAAATGGGGAAGG + Intergenic
950544412 3:13630081-13630103 TTGGGCCAGACAGAGGAGGAAGG - Intronic
951707524 3:25558263-25558285 TTGTAGCAGAGCAATAAGGATGG - Intronic
952985528 3:38777644-38777666 TTCAAGAAGACAAATAAGGAGGG + Intronic
953183358 3:40616511-40616533 GGGGAGCAGATAAAGGAGGACGG + Intergenic
955487115 3:59446464-59446486 TTGTAGCAGAAAAATTGGGAAGG - Intergenic
956191667 3:66614002-66614024 TTAGAGCAGCCAAATTAAGATGG + Intergenic
957166564 3:76681665-76681687 CTGGAGCAGACAAGAGAGTATGG + Intronic
957361440 3:79164524-79164546 ATAAAGCAGGCAAATGAGGATGG - Intronic
957726457 3:84073001-84073023 TGTGATCAGACAAATAAGGAGGG + Intergenic
958477005 3:94597305-94597327 TCAGAGGAGAGAAATGAGGAAGG - Intergenic
959355460 3:105322483-105322505 TTGGAGCACTGAGATGAGGAAGG - Intergenic
960185648 3:114634918-114634940 TAGGAGCAAAGAAATGAGGAGGG + Intronic
960235863 3:115281296-115281318 TTGGAACAGGGAAAGGAGGATGG - Intergenic
960391514 3:117082962-117082984 TAGGAGCAGAGAAATGGGGCAGG - Intronic
960394240 3:117116999-117117021 TCAAAGAAGACAAATGAGGATGG - Intronic
961947704 3:130711440-130711462 GTGGAGCAGAGAAATGAAGGAGG + Intronic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
962962876 3:140327507-140327529 TTTGAGGAGAGATATGAGGAAGG - Intronic
965996522 3:174889537-174889559 TGGAAGCAGAGAAGTGAGGATGG - Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966095136 3:176190893-176190915 TGGGAGCAGACAGATGAAGCAGG + Intergenic
968266024 3:197364045-197364067 CTGGTGCAGACAAATGAGTGAGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969328902 4:6461562-6461584 TGGGAGCTGACAGATGAGAAGGG + Intronic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
971684266 4:29744716-29744738 TTTGAGAACACAAATAAGGAAGG - Intergenic
971804580 4:31339272-31339294 TGGGAGTACACAAAGGAGGAGGG - Intergenic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
975047406 4:69823037-69823059 TTGCTGCAGAAAAATCAGGAGGG + Intronic
976020633 4:80620704-80620726 TTTAAGCAGACAAAAGAGGCAGG - Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977565601 4:98577404-98577426 TGGGAGAAGGCAAATGATGAGGG - Intronic
980006390 4:127547188-127547210 GTTTAGCAGACAAATGATGAGGG + Intergenic
981116861 4:141001366-141001388 GTAGAGAAGACAAATGAAGAGGG - Intronic
981802280 4:148672361-148672383 TTGAAGTATACAAATGAGTAAGG + Intergenic
982712658 4:158772508-158772530 TTGGAGCAGTTAAATGAAGTAGG + Intronic
984100840 4:175483844-175483866 TTGAAGTTGACAAATGAAGAGGG + Intergenic
984739638 4:183148520-183148542 TTTAAGCAGAGAAATGGGGAAGG - Intronic
987068072 5:14308900-14308922 ATGGACTAGACAAATGTGGATGG - Intronic
987356710 5:17069704-17069726 TTGGGGCAGCCAATCGAGGATGG + Intronic
988991371 5:36674166-36674188 TTATAGCAGAGAAATGAGCAGGG - Intronic
989185526 5:38621635-38621657 ATGGAGCTGAGATATGAGGAAGG - Intergenic
992358939 5:76016213-76016235 GTGCAGCAGAAAAAAGAGGAAGG + Intergenic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
994591736 5:101782761-101782783 TTGGGGCAGAGAAAATAGGAAGG + Intergenic
996167009 5:120236594-120236616 CTGGAACATGCAAATGAGGATGG - Intergenic
997033818 5:130162755-130162777 TTGGAGCAGAACTGTGAGGAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
998737665 5:145161024-145161046 GTGGATGAGACAAATGAGGTAGG - Intergenic
999107322 5:149085331-149085353 TGGGGGCAGAAATATGAGGAGGG - Intergenic
1000927014 5:167206168-167206190 TTGGAGGAGACAAATCCAGATGG - Intergenic
1002569836 5:180134074-180134096 CTGGAGCAGACTGATGAGGCAGG - Intronic
1002624479 5:180515601-180515623 TTGAAGTTGAGAAATGAGGAGGG + Intronic
1003432011 6:6047549-6047571 TGGGTGGAGACAAATGAGGCAGG + Intergenic
1004948073 6:20637260-20637282 GGGGAGTAAACAAATGAGGAAGG + Intronic
1006851049 6:37098894-37098916 TCGGAGCAGACAAATAAGTGGGG - Intergenic
1007032538 6:38640930-38640952 TTGGAGGAGACAAATTGGGAAGG + Intergenic
1007274147 6:40661212-40661234 GTGGAGGAGACAGATGGGGACGG - Intergenic
1009826435 6:68871220-68871242 TTGTAATAGACAACTGAGGATGG - Intronic
1010109177 6:72204137-72204159 TGGGAGCACATAAATGAGGGAGG + Intronic
1010863754 6:80946829-80946851 TTGAAGTAGATAAATGAGGAAGG - Intergenic
1012075906 6:94685607-94685629 ATGGAACAGAAAACTGAGGAAGG - Intergenic
1012252763 6:96997165-96997187 ATTGAGCAAGCAAATGAGGAAGG + Intronic
1013351240 6:109307600-109307622 TTGGAGCACAATAATGATGAAGG + Intergenic
1013752468 6:113423227-113423249 TTAGAGGAGACAAAGGAGTATGG - Intergenic
1014116518 6:117673832-117673854 TTGGGGCAAAGAAATGAGTACGG + Intergenic
1015698896 6:136012708-136012730 TTTTAGCTGAGAAATGAGGAAGG + Intronic
1016742325 6:147541601-147541623 TGTGACCAGACAAATAAGGAGGG + Intronic
1018773580 6:166993824-166993846 TTGTAGGAGTCAAATGAGGTAGG + Intergenic
1018801731 6:167227924-167227946 TGTGACCAGACAAATAAGGAGGG - Intergenic
1019934919 7:4247880-4247902 CTGGAGGAGACCAATGGGGAGGG - Intronic
1020288653 7:6706184-6706206 CTGGAGCAGAGAGAGGAGGAAGG + Intronic
1023305825 7:38825892-38825914 CTGATGCAGAGAAATGAGGACGG + Intronic
1023800218 7:43827311-43827333 TGTGACCAGACAAATAAGGAGGG - Intergenic
1024109391 7:46130006-46130028 TTGCAGCAGACACCTGTGGATGG + Intergenic
1025186348 7:56862656-56862678 TTGCAGCAACCAAAGGAGGAGGG - Intergenic
1025685574 7:63714242-63714264 TTGCAGCAACCAAAGGAGGAGGG + Intergenic
1026128714 7:67602650-67602672 TTGGTGGAGATAAATGGGGAAGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028451788 7:90993446-90993468 TTGGAGCAGGCAAGAGAGGATGG + Intronic
1030364128 7:108626845-108626867 TGTGAGCAGACAAATAAGGAGGG + Intergenic
1031072668 7:117179634-117179656 TTAGAGCAGAGGGATGAGGAGGG + Intronic
1032470408 7:132174572-132174594 TTGGAGCAGAGATGTGAGTAGGG - Intronic
1034432992 7:151050259-151050281 AGGGAGCACACAAATGAGGCTGG + Intronic
1035333828 7:158113167-158113189 TTGGTCCAGAGAGATGAGGATGG + Intronic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1035937085 8:3852777-3852799 TTGGAGGAGACAGAAGAGGCTGG - Intronic
1037370882 8:18177167-18177189 TGGGAAGAGACAGATGAGGAAGG - Intronic
1037796282 8:21997920-21997942 GTGGAGCAGACAAAAGAGTCAGG + Intronic
1038353543 8:26805225-26805247 TGAGAGTGGACAAATGAGGAAGG - Intronic
1039226213 8:35391278-35391300 CTGGAGCTGAGAAATGATGATGG - Intronic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1042089242 8:65140759-65140781 TTTGAGCAGAGAAATCAGTAAGG + Intergenic
1042841277 8:73126367-73126389 CTGTAGCACACAAATGGGGATGG - Intergenic
1042975212 8:74461115-74461137 TAAGAGCAGAAAAATGAAGAGGG - Intronic
1044641450 8:94386174-94386196 TGGTACCAGAAAAATGAGGATGG + Intronic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1045956626 8:107915673-107915695 TGTGACCAGACAAATAAGGAGGG - Intronic
1046974026 8:120253358-120253380 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1047104714 8:121720064-121720086 TTGGTGCTGACAAACGTGGAAGG - Intergenic
1048607532 8:135985080-135985102 TTCCAGCACACAAATGAGGCAGG - Intergenic
1050315830 9:4399951-4399973 TTGGAGCAGAAATAGGAGGTGGG + Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1052175023 9:25450517-25450539 TTAGAGCAGACAACCGAGAAGGG - Intergenic
1055249580 9:74286947-74286969 TTGGACCAGAAAAATAATGAGGG - Intergenic
1056687048 9:88775508-88775530 TGAGAGCAGACAATGGAGGAGGG + Intergenic
1057543140 9:95994636-95994658 TTGGAGTATACAGATGAGCAGGG + Intronic
1058429094 9:104902315-104902337 TTGTAGCAAACTCATGAGGATGG + Intronic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1059819058 9:117951427-117951449 CTGGAGGAGACAAAGGGGGAGGG - Intergenic
1060061110 9:120460567-120460589 TTGCAGCAGAGTAATGAGGTAGG - Exonic
1061115641 9:128609463-128609485 TTAATGGAGACAAATGAGGAAGG - Intronic
1061267027 9:129512159-129512181 TTGGAGGAGGCACAGGAGGAGGG + Intergenic
1061400362 9:130365086-130365108 GAGGAGCAGACAGGTGAGGAAGG - Intronic
1061890121 9:133614880-133614902 TGGGAGCAGAGAAAGGAGAATGG + Intergenic
1062109222 9:134772956-134772978 TTGGCGGAGACACCTGAGGAAGG - Intronic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186094193 X:6082211-6082233 TTGAAAAAGACAAATGAGGTAGG + Intronic
1188687201 X:33083548-33083570 TGTGACCAGACAAATAAGGAGGG + Intronic
1190981225 X:55458100-55458122 TTGGAGGAAAGAAATGAAGAAGG + Intergenic
1190987473 X:55515080-55515102 TTGGAGGAAAGAAATGAAGAAGG - Intergenic
1192363075 X:70451500-70451522 TTGCAGCAGTCCTATGAGGAAGG - Intronic
1192367317 X:70484795-70484817 TTGAGACAGACAAAGGAGGAAGG + Intronic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1195569759 X:106385139-106385161 TTGGAGAAGACAAAAAGGGAGGG - Intergenic
1197421733 X:126243986-126244008 TGGCAGAAAACAAATGAGGATGG - Intergenic
1201266117 Y:12208385-12208407 TTGGAGAAGACAGTTGAAGAGGG - Intergenic